Rmu_sc0001009.1_g000026

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001009.1
OG0001602
Physical Location & Seq
Forward (+)
122429 .. 123271
843 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001009.1_g000026.1.cds

Sequence Viewer

Length: 843 bp
atgtgggaggatcccaactcaagcatttacaacaatggttggactaatgctaactcttcatggaattcggaagcgttcaactcatggaaaccttataaagtccctatgtatgatccttatcatcacaatattgattcattcatgtggccgtcatacaaagatcaagtaccagtcctcttggttgatccaatgaagccctcccttgaggcaattgtacaagcagttgcgaaaagtgcggaagaatcatcaaggaatatggacaaagccgtggagaatattgagcgacatatccagcaaattactaattctttgaaccaagaaacagaggagcgggaaatacaatgttgggttcaagagtcatatcatgaggtgttgatgagtgaggaagaagattgggcagaagctaatgagcctttggaggccaaggtacttatggagtgccctcctacacctatgacaactttagggcagtcccttgaagtcacggccttacctcaacctcataatgtattccatgagtccattttggatgaggatgaggatacagatttagatgagccctatgaaaataaacttgaggctgggacgtgtgaggattatgtgttacactctacaactaagcttgaagcatatgaagatagtgatattgaagaatccttgacaaacgaggaattttacattaaagaaagtaaggttcaacttcatgcgaatgagtaccaagtgccgaaagcaatcatcatagctcataaagatcaagaatacaaggatgacatggaggattgcttagaagaggagtccagcaaatctcctatagacgggcctctaattctatcacatgggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

280

Amino Acids

32.31

Weight (kDa)

4.25

Isoelectric Point (pI)

62.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 96
AccBSI CCGCTC 1 cut(s) 331
AciI CCGC 2 cut(s) 236, 331
AclWI GGATC 4 cut(s) 5, 18, 107, 179
AcoI YGGCCR 1 cut(s) 146
AcsI RAATTY 2 cut(s) 64, 671
AfaI GTAC 4 cut(s) 168, 216, 429, 716
AfiI CCNNNNNNNGG 1 cut(s) 815
AflIII ACRYGT 1 cut(s) 587
AgsI TTSAA 7 cut(s) 79, 313, 353, 479, 626, 650, 698
AjiI CACGTC 1 cut(s) 588
AleI CACNNNNGTG 1 cut(s) 838
AluBI AGCT 3 cut(s) 404, 622, 743
AluI AGCT 3 cut(s) 404, 622, 743
AlwI GGATC 4 cut(s) 5, 18, 107, 179
AoxI GGCC 4 cut(s) 146, 420, 486, 818
ApoI RAATTY 2 cut(s) 64, 671
AspS9I GGNCC 1 cut(s) 818
BaeGI GKGCMC 1 cut(s) 443
BamHI GGATCC 1 cut(s) 10
BanII GRGCYC 1 cut(s) 561
BceAI ACGGC 3 cut(s) 133, 251, 501
BciVI GTATCC 1 cut(s) 535
BfmI CTRYAG 1 cut(s) 810
BfuI GTATCC 1 cut(s) 535
BmgBI CACGTC 1 cut(s) 588
BmgT120I GGNCC 1 cut(s) 818
BmiI GGNNCC 1 cut(s) 12
BpuEI CTTGAG 3 cut(s) 4, 224, 596
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 2 cut(s) 267, 423
Bsc4I CCNNNNNNNGG 1 cut(s) 815
Bse1I ACTGG 1 cut(s) 170
Bse8I GATNNNNATC 1 cut(s) 117
BseDI CCNNGG 2 cut(s) 267, 423
BseGI GGATG 3 cut(s) 535, 541, 772
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 1 cut(s) 815
BseNI ACTGG 1 cut(s) 170
BseRI GAGGAG 2 cut(s) 341, 806
BseSI GKGCMC 1 cut(s) 443
BseYI CCCAGC 1 cut(s) 581
BshFI GGCC 4 cut(s) 148, 422, 488, 820
BslFI GGGAC 3 cut(s) 86, 457, 598
BslI CCNNNNNNNGG 1 cut(s) 815
BsmFI GGGAC 3 cut(s) 86, 457, 598
BsnI GGCC 4 cut(s) 148, 422, 488, 820
Bsp1286I GDGCHC 2 cut(s) 443, 561
Bsp1407I TGTACA 1 cut(s) 214
Bsp143I GATC 5 cut(s) 10, 112, 160, 184, 751
BspACI CCGC 2 cut(s) 236, 331
BspANI GGCC 4 cut(s) 148, 422, 488, 820
BspHI TCATGA 1 cut(s) 364
BspLI GGNNCC 1 cut(s) 12
BspPI GGATC 4 cut(s) 5, 18, 107, 179
BsrBI CCGCTC 1 cut(s) 331
BsrGI TGTACA 1 cut(s) 214
BsrI ACTGG 1 cut(s) 170
BssECI CCNNGG 2 cut(s) 267, 423
BssMI GATC 5 cut(s) 10, 112, 160, 184, 751
BssT1I CCWWGG 1 cut(s) 423
Bst6I CTCTTC 2 cut(s) 61, 783
BstAUI TGTACA 1 cut(s) 214
BstDEI CTNAG 2 cut(s) 618, 784
BstDSI CCRYGG 1 cut(s) 267
BstF5I GGATG 3 cut(s) 535, 541, 772
BstKTI GATC 5 cut(s) 13, 115, 163, 187, 754
BstMBI GATC 5 cut(s) 10, 112, 160, 184, 751
BstMWI GCNNNNNNNGC 1 cut(s) 233
BstSFI CTRYAG 1 cut(s) 810
BstSLI GKGCMC 1 cut(s) 443
BstX2I RGATCY 1 cut(s) 10
BstYI RGATCY 1 cut(s) 10
BsuI GTATCC 1 cut(s) 535
BsuRI GGCC 4 cut(s) 148, 422, 488, 820
BtgI CCRYGG 1 cut(s) 267
BtrI CACGTC 1 cut(s) 588
BtsCI GGATG 3 cut(s) 535, 541, 772
CciI TCATGA 1 cut(s) 364
Cfr13I GGNCC 1 cut(s) 818
Csp6I GTAC 4 cut(s) 167, 215, 428, 715
CviAII CATG 8 cut(s) 60, 84, 142, 365, 515, 704, 772, 836
CviQI GTAC 4 cut(s) 167, 215, 428, 715
DdeI CTNAG 2 cut(s) 618, 784
DpnI GATC 5 cut(s) 12, 114, 162, 186, 753
DpnII GATC 5 cut(s) 10, 112, 160, 184, 751
EaeI YGGCCR 1 cut(s) 146
Eam1104I CTCTTC 2 cut(s) 61, 783
EarI CTCTTC 2 cut(s) 61, 783
Eco130I CCWWGG 1 cut(s) 423
Eco24I GRGCYC 1 cut(s) 561
EcoRI GAATTC 1 cut(s) 64
EcoT14I CCWWGG 1 cut(s) 423
EcoT38I GRGCYC 1 cut(s) 561
ErhI CCWWGG 1 cut(s) 423
FaeI CATG 8 cut(s) 63, 87, 145, 368, 518, 707, 775, 839
FaqI GGGAC 3 cut(s) 86, 457, 598
FatI CATG 8 cut(s) 59, 83, 141, 364, 514, 703, 771, 835
FauI CCCGC 1 cut(s) 324
FauNDI CATATG 1 cut(s) 631
FokI GGATG 3 cut(s) 542, 548, 779
FriOI GRGCYC 1 cut(s) 561
GsaI CCCAGC 1 cut(s) 585
HaeIII GGCC 4 cut(s) 148, 422, 488, 820
Hin1II CATG 8 cut(s) 63, 87, 145, 368, 518, 707, 775, 839
HindIII AAGCTT 1 cut(s) 620
HinfI GANTC 6 cut(s) 134, 242, 356, 518, 653, 794
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 3 cut(s) 353, 365, 755
HpyCH4IV ACGT 1 cut(s) 587
HpyF10VI GCNNNNNNNGC 1 cut(s) 233
HpyF3I CTNAG 2 cut(s) 618, 784
HpySE526I ACGT 1 cut(s) 587
Hsp92II CATG 8 cut(s) 63, 87, 145, 368, 518, 707, 775, 839
Kzo9I GATC 5 cut(s) 10, 112, 160, 184, 751
LmnI GCTCC 1 cut(s) 328
LpnPI CCDG 4 cut(s) 183, 305, 567, 811
MaeII ACGT 1 cut(s) 587
MaeIII GTNAC 2 cut(s) 481, 603
MalI GATC 5 cut(s) 12, 114, 162, 186, 753
MbiI CCGCTC 1 cut(s) 331
MboI GATC 5 cut(s) 10, 112, 160, 184, 751
MboII GAAGA 7 cut(s) 48, 251, 398, 401, 647, 662, 800
MfeI CAATTG 1 cut(s) 210
MflI RGATCY 1 cut(s) 10
MhlI GDGCHC 2 cut(s) 443, 561
MluCI AATT 6 cut(s) 64, 210, 297, 304, 671, 825
MlyI GAGTC 3 cut(s) 365, 527, 803
MmeI TCCRAC 1 cut(s) 20
MseI TTAA 1 cut(s) 681
MslI CAYNNNNRTG 3 cut(s) 142, 708, 838
MunI CAATTG 1 cut(s) 210
MwoI GCNNNNNNNGC 1 cut(s) 233
NdeI CATATG 1 cut(s) 631
NdeII GATC 5 cut(s) 10, 112, 160, 184, 751
NlaIII CATG 8 cut(s) 63, 87, 145, 368, 518, 707, 775, 839
NlaIV GGNNCC 1 cut(s) 12
NmuCI GTSAC 1 cut(s) 481
OliI CACNNNNGTG 1 cut(s) 838
PagI TCATGA 1 cut(s) 364
PfeI GAWTC 3 cut(s) 134, 242, 653
PleI GAGTC 3 cut(s) 364, 526, 802
PpsI GAGTC 3 cut(s) 364, 526, 802
PsiI TTATAA 1 cut(s) 96
PspFI CCCAGC 1 cut(s) 581
PspN4I GGNNCC 1 cut(s) 12
PspPI GGNCC 1 cut(s) 818
PsuI RGATCY 1 cut(s) 10
RsaI GTAC 4 cut(s) 168, 216, 429, 716
RsaNI GTAC 4 cut(s) 167, 215, 428, 715
RseI CAYNNNNRTG 3 cut(s) 142, 708, 838
SaqAI TTAA 1 cut(s) 681
Sau3AI GATC 5 cut(s) 10, 112, 160, 184, 751
Sau96I GGNCC 1 cut(s) 818
SchI GAGTC 3 cut(s) 365, 527, 803
SduI GDGCHC 2 cut(s) 443, 561
SfcI CTRYAG 1 cut(s) 810
SmiMI CAYNNNNRTG 3 cut(s) 142, 708, 838
SmlI CTYRAG 3 cut(s) 19, 203, 575
SmoI CTYRAG 3 cut(s) 19, 203, 575
Sse9I AATT 6 cut(s) 64, 210, 297, 304, 671, 825
SsiI CCGC 2 cut(s) 236, 331
SspI AATATT 2 cut(s) 130, 277
StyI CCWWGG 1 cut(s) 423
TaiI ACGT 1 cut(s) 590
TasI AATT 6 cut(s) 64, 210, 297, 304, 671, 825
TatI WGTACW 1 cut(s) 214
TfiI GAWTC 3 cut(s) 134, 242, 653
Tru1I TTAA 1 cut(s) 681
Tru9I TTAA 1 cut(s) 681
TseFI GTSAC 1 cut(s) 481
Tsp45I GTSAC 1 cut(s) 481
TspDTI ATGAA 7 cut(s) 48, 126, 130, 206, 579, 648, 692
XapI RAATTY 2 cut(s) 64, 671
XcmI CCANNNNNNNNNTGG 1 cut(s) 430
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.