Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010589.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Forward (+)

16512 .. 17658

Gene Structure 1147 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010589.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1053 bp

atgatgtgggaggatcccaactcaagcatttacaacaatggttggactaatgctaactcttcatggaatccggaagcgttcaactcatggcaaccttatcaagtccctatgtatgatccttatcatcacaatattgattcactcatgtggtcatcataccaagatcaagtaccagtcctcttggttgatccaatgaagccctcccttgaggcaattgtacaagcagttgtgaaaagtgcggaagaatcatcaaggaatatggacaaagccatggagaatattgagcaacatatccagcaaattattaattctttgaaccaagaaacagaggagcgggaaatacaatgttgggttcaagagtcatatcatgaggtgttgacgagtgaggaagaagattgggcagaagctaatgagcctttggaggccaaggatgaggatacagatttggatgagtcctatgaaaagaaacttgaggttgggacgtgtgaggattatgtgtcacaccatacgatcgagcttgaagcatatgaagatagtgatattgaagagtccttgacaaatgaggaattttacattaaagaaagtaaggttcaacttcatgtgaatgagtaccaagtgccggaagcaatcatcatagcacataaagatcaagaatacaaggatgacatggaggattgcttagaagaggagtccagcaaatctcctatagacgggcctctaattctatcacatggccgaccacctgaccattacttgccacattcgagctttacatttgttccctccatacaagaaactcttgagtttgtggatcatgtggagatggtgatatgtgaatatctgaattctgataagaagattcttttggccgtgcttgtggaacataagaagagaacgagacaatggaagaagagaaagaaaatgagaaagttgaaatcctatctttccattgttaccaaggagcacaagtcacttacaagggatcacctagcatctttgaaaaaggtcaagcatctcatggaaccaagaccaaaacctcctgattactcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

350

Amino Acids

41.1

Weight (kDa)

4.77

Isoelectric Point (pI)

54.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	334
AccIII	TCCGGA	1 cut(s)	70
AciI	CCGC	2 cut(s)	239, 334
AclWI	GGATC	6 cut(s)	8, 21, 110, 182, 819, 990
AcoI	YGGCCR	2 cut(s)	733, 867
AcsI	RAATTY	2 cut(s)	566, 844
AfaI	GTAC	3 cut(s)	171, 219, 611
AfiI	CCNNNNNNNGG	2 cut(s)	619, 710
AflIII	ACRYGT	1 cut(s)	482
AgsI	TTSAA	8 cut(s)	82, 316, 356, 521, 545, 593, 934, 1000
AjiI	CACGTC	1 cut(s)	483
AjuI	GAANNNNNNNTTGG	2 cut(s)	848, 880
AleI	CACNNNNGTG	1 cut(s)	145
AluBI	AGCT	3 cut(s)	407, 517, 768
AluI	AGCT	3 cut(s)	407, 517, 768
Alw21I	GWGCWC	1 cut(s)	966
Alw26I	GTCTC	1 cut(s)	892
AlwI	GGATC	6 cut(s)	8, 21, 110, 182, 819, 990
Aor13HI	TCCGGA	1 cut(s)	70
AoxI	GGCC	4 cut(s)	423, 713, 733, 867
ApoI	RAATTY	2 cut(s)	566, 844
AseI	ATTAAT	1 cut(s)	306
AspS9I	GGNCC	1 cut(s)	713
AsuHPI	GGTGA	2 cut(s)	838, 977
BamHI	GGATCC	1 cut(s)	13
Bbv12I	GWGCWC	1 cut(s)	966
BccI	CCATC	1 cut(s)	817
BceAI	ACGGC	1 cut(s)	854
BciVI	GTATCC	1 cut(s)	430
BcoDI	GTCTC	1 cut(s)	892
BfaI	CTAG	1 cut(s)	989
BfmI	CTRYAG	1 cut(s)	705
BfuI	GTATCC	1 cut(s)	430
BmgBI	CACGTC	1 cut(s)	483
BmgT120I	GGNCC	1 cut(s)	713
BmiI	GGNNCC	2 cut(s)	15, 1023
BmsI	GCATC	2 cut(s)	1001, 1021
BpuEI	CTTGAG	4 cut(s)	7, 227, 491, 821
BsaBI	GATNNNNATC	1 cut(s)	120
BsaJI	CCNNGG	3 cut(s)	270, 426, 957
BsaWI	WCCGGW	1 cut(s)	70
BsaXI	ACNNNNNCTCC	2 cut(s)	953, 983
Bsc4I	CCNNNNNNNGG	2 cut(s)	619, 710
Bse1I	ACTGG	1 cut(s)	173
Bse8I	GATNNNNATC	1 cut(s)	120
BseAI	TCCGGA	1 cut(s)	70
BseDI	CCNNGG	3 cut(s)	270, 426, 957
BseGI	GGATG	3 cut(s)	436, 454, 667
BseJI	GATNNNNATC	1 cut(s)	120
BseLI	CCNNNNNNNGG	2 cut(s)	619, 710
BseNI	ACTGG	1 cut(s)	173
BseRI	GAGGAG	2 cut(s)	344, 701
Bsh1285I	CGRYCG	1 cut(s)	513
BshFI	GGCC	4 cut(s)	425, 715, 735, 869
BsiEI	CGRYCG	1 cut(s)	513
BsiHKAI	GWGCWC	1 cut(s)	966
BsiSI	CCGG	2 cut(s)	71, 620
BslFI	GGGAC	2 cut(s)	89, 493
BslI	CCNNNNNNNGG	2 cut(s)	619, 710
BsmAI	GTCTC	1 cut(s)	892
BsmFI	GGGAC	2 cut(s)	89, 493
BsnI	GGCC	4 cut(s)	425, 715, 735, 869
Bsp1286I	GDGCHC	1 cut(s)	966
Bsp13I	TCCGGA	1 cut(s)	70
Bsp1407I	TGTACA	1 cut(s)	217
Bsp143I	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
Bsp19I	CCATGG	1 cut(s)	270
BspACI	CCGC	2 cut(s)	239, 334
BspANI	GGCC	4 cut(s)	425, 715, 735, 869
BspEI	TCCGGA	1 cut(s)	70
BspHI	TCATGA	1 cut(s)	367
BspLI	GGNNCC	2 cut(s)	15, 1023
BspPI	GGATC	6 cut(s)	8, 21, 110, 182, 819, 990
BsrBI	CCGCTC	1 cut(s)	334
BsrGI	TGTACA	1 cut(s)	217
BsrI	ACTGG	1 cut(s)	173
BssECI	CCNNGG	3 cut(s)	270, 426, 957
BssMI	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
BssT1I	CCWWGG	3 cut(s)	270, 426, 957
Bst6I	CTCTTC	5 cut(s)	64, 540, 678, 884, 905
BstAUI	TGTACA	1 cut(s)	217
BstDEI	CTNAG	1 cut(s)	679
BstDSI	CCRYGG	1 cut(s)	270
BstF5I	GGATG	3 cut(s)	436, 454, 667
BstKTI	GATC	8 cut(s)	16, 118, 166, 190, 513, 649, 814, 985
BstMAI	GTCTC	1 cut(s)	892
BstMBI	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
BstMCI	CGRYCG	1 cut(s)	513
BstSFI	CTRYAG	1 cut(s)	705
BstX2I	RGATCY	1 cut(s)	13
BstYI	RGATCY	1 cut(s)	13
BsuI	GTATCC	1 cut(s)	430
BsuRI	GGCC	4 cut(s)	425, 715, 735, 869
BtgI	CCRYGG	1 cut(s)	270
BtrI	CACGTC	1 cut(s)	483
BtsCI	GGATG	3 cut(s)	436, 454, 667
CciI	TCATGA	1 cut(s)	367
Cfr13I	GGNCC	1 cut(s)	713
Csp6I	GTAC	3 cut(s)	170, 218, 610
CviQI	GTAC	3 cut(s)	170, 218, 610
DdeI	CTNAG	1 cut(s)	679
DpnI	GATC	8 cut(s)	15, 117, 165, 189, 512, 648, 813, 984
DpnII	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
EaeI	YGGCCR	2 cut(s)	733, 867
Eam1104I	CTCTTC	5 cut(s)	64, 540, 678, 884, 905
EarI	CTCTTC	5 cut(s)	64, 540, 678, 884, 905
Eco130I	CCWWGG	3 cut(s)	270, 426, 957
EcoRI	GAATTC	1 cut(s)	844
EcoT14I	CCWWGG	3 cut(s)	270, 426, 957
ErhI	CCWWGG	3 cut(s)	270, 426, 957
FalI	AAGNNNNNCTT	2 cut(s)	783, 815
FaqI	GGGAC	2 cut(s)	89, 493
FauI	CCCGC	1 cut(s)	327
FauNDI	CATATG	1 cut(s)	526
FokI	GGATG	3 cut(s)	443, 461, 674
FspBI	CTAG	1 cut(s)	989
HaeIII	GGCC	4 cut(s)	425, 715, 735, 869
HapII	CCGG	2 cut(s)	71, 620
HincII	GTYRAC	1 cut(s)	378
HindII	GTYRAC	1 cut(s)	378
HinfI	GANTC	8 cut(s)	67, 137, 245, 359, 452, 548, 689, 859
HpaII	CCGG	2 cut(s)	71, 620
HphI	GGTGA	2 cut(s)	838, 977
Hpy166II	GTNNAC	1 cut(s)	378
Hpy188I	TCNGA	2 cut(s)	843, 850
Hpy188III	TCNNGA	6 cut(s)	71, 356, 368, 650, 800, 1040
Hpy8I	GTNNAC	1 cut(s)	378
HpyCH4IV	ACGT	1 cut(s)	482
HpyF3I	CTNAG	1 cut(s)	679
HpySE526I	ACGT	1 cut(s)	482
Kpn2I	TCCGGA	1 cut(s)	70
Kzo9I	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
LmnI	GCTCC	2 cut(s)	331, 961
LpnPI	CCDG	6 cut(s)	84, 186, 308, 633, 706, 756
LweI	GCATC	2 cut(s)	1001, 1021
MaeI	CTAG	1 cut(s)	989
MaeII	ACGT	1 cut(s)	482
MaeIII	GTNAC	3 cut(s)	498, 952, 969
MalI	GATC	8 cut(s)	15, 117, 165, 189, 512, 648, 813, 984
MbiI	CCGCTC	1 cut(s)	334
MboI	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
MfeI	CAATTG	1 cut(s)	213
MflI	RGATCY	1 cut(s)	13
MhlI	GDGCHC	1 cut(s)	966
MluCI	AATT	6 cut(s)	213, 300, 307, 566, 720, 844
MlyI	GAGTC	4 cut(s)	368, 461, 557, 698
MmeI	TCCRAC	1 cut(s)	23
MroI	TCCGGA	1 cut(s)	70
MseI	TTAA	3 cut(s)	306, 576, 1051
MslI	CAYNNNNRTG	2 cut(s)	145, 603
MspI	CCGG	2 cut(s)	71, 620
MunI	CAATTG	1 cut(s)	213
NcoI	CCATGG	1 cut(s)	270
NdeI	CATATG	1 cut(s)	526
NdeII	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
NlaIV	GGNNCC	2 cut(s)	15, 1023
NmuCI	GTSAC	2 cut(s)	498, 969
OliI	CACNNNNGTG	1 cut(s)	145
PagI	TCATGA	1 cut(s)	367
PfeI	GAWTC	4 cut(s)	67, 137, 245, 859
Ple19I	CGATCG	1 cut(s)	513
PleI	GAGTC	4 cut(s)	367, 460, 556, 697
PpsI	GAGTC	4 cut(s)	367, 460, 556, 697
PshBI	ATTAAT	1 cut(s)	306
PspN4I	GGNNCC	2 cut(s)	15, 1023
PspPI	GGNCC	1 cut(s)	713
PsuI	RGATCY	1 cut(s)	13
PvuI	CGATCG	1 cut(s)	513
RsaI	GTAC	3 cut(s)	171, 219, 611
RsaNI	GTAC	3 cut(s)	170, 218, 610
RseI	CAYNNNNRTG	2 cut(s)	145, 603
SaqAI	TTAA	3 cut(s)	306, 576, 1051
Sau3AI	GATC	8 cut(s)	13, 115, 163, 187, 510, 646, 811, 982
Sau96I	GGNCC	1 cut(s)	713
SchI	GAGTC	4 cut(s)	368, 461, 557, 698
SduI	GDGCHC	1 cut(s)	966
SfaNI	GCATC	2 cut(s)	1001, 1021
SfcI	CTRYAG	1 cut(s)	705
SmiMI	CAYNNNNRTG	2 cut(s)	145, 603
SmlI	CTYRAG	4 cut(s)	22, 206, 470, 800
SmoI	CTYRAG	4 cut(s)	22, 206, 470, 800
Sse9I	AATT	6 cut(s)	213, 300, 307, 566, 720, 844
SsiI	CCGC	2 cut(s)	239, 334
SspI	AATATT	2 cut(s)	133, 280
SspMI	CTAG	1 cut(s)	989
StyI	CCWWGG	3 cut(s)	270, 426, 957
TaiI	ACGT	1 cut(s)	485
TaqI	TCGA	2 cut(s)	513, 764
TasI	AATT	6 cut(s)	213, 300, 307, 566, 720, 844
TatI	WGTACW	1 cut(s)	217
TfiI	GAWTC	4 cut(s)	67, 137, 245, 859
Tru1I	TTAA	3 cut(s)	306, 576, 1051
Tru9I	TTAA	3 cut(s)	306, 576, 1051
TseFI	GTSAC	2 cut(s)	498, 969
Tsp45I	GTSAC	2 cut(s)	498, 969
TspDTI	ATGAA	5 cut(s)	51, 209, 474, 543, 587
VspI	ATTAAT	1 cut(s)	306
XapI	RAATTY	2 cut(s)	566, 844
XspI	CTAG	1 cut(s)	989

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.