Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000334.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Reverse (-)

67825 .. 68982

Gene Structure 1158 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000334.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1158 bp

atgtgggaagatcccaactcaagcatttacaacaatggttggactaatgctaactcttcatggaatccggaagcgttcaactcatggcaaccttatcaagtccctatgtatgatccttatcatcacaatattgattcactcatgtggccatcataccaagatctagtaccagtcctcttggttgatccaatgaagccctcccttgaggcaattgtacaagcagttgcgaaaagtgcggaagaatcatcaaggaatatggaaaaagccgtggagaatattgagcgacatatccagcaaattactaattctttgaaccaagaaacagaggagcgggaaatacaatattgggttcaagagtcatatcatgaggtgttgacgagtgaggaagaagattgggcagaagctaatgagcctttggaggccaaggtacttatggagtgccctcctacacttactacaactttagggcagccccttgaagtcacagtcttacctcaacctcataatgcattccatgagtcaattttggatgaggatgaggatacagatgtggatgagccctatgaaaagaaaattgaggttgggacgtgtgaggattatgtgtcacaccatacaaccaagcttgaagcatatgaagatagtgatattgaagagtccttgacaaacgaggaattttacattaaagaaagtaaggttcaacttcatgcgaatgagtaccaagtgccggaagcaatcatcatagctcataaagatcaagaatacaaggatgacatggaggattgcttagaagaggagtccagtaaatctcctatagacgggcttctaattctatcacatgcccgaccacctgaccattacttgccatattcgagctttacatttgttcccaccatacaagaaactcttgagtttgttgatcatgtggagatggtgatagatgaatatcccaattctgataagaagattcttttggccgtgcttgtgggacataagaagagaatgacacaatggaagaagagaaagaaaacgagaaagttgaaatcctatctttccattgttaccaaggagcacaagttgcttacaagggatcacctagcatctttgaaaaaggtcaagcatctcatggaaccaagaccaaagcctcctgattactcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

385

Amino Acids

44.87

Weight (kDa)

4.74

Isoelectric Point (pI)

53.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	331
AccIII	TCCGGA	1 cut(s)	67
AciI	CCGC	2 cut(s)	236, 331
AclWI	GGATC	4 cut(s)	5, 107, 179, 1095
AcoI	YGGCCR	2 cut(s)	146, 972
AcsI	RAATTY	1 cut(s)	671
AfaI	GTAC	4 cut(s)	168, 216, 429, 716
AfiI	CCNNNNNNNGG	2 cut(s)	724, 815
AflIII	ACRYGT	1 cut(s)	587
AgsI	TTSAA	9 cut(s)	79, 313, 353, 479, 626, 650, 698, 1039, 1105
AjiI	CACGTC	1 cut(s)	588
AjuI	GAANNNNNNNTTGG	2 cut(s)	953, 985
AleI	CACNNNNGTG	1 cut(s)	142
AluBI	AGCT	4 cut(s)	404, 622, 743, 873
AluI	AGCT	4 cut(s)	404, 622, 743, 873
Alw21I	GWGCWC	1 cut(s)	1071
AlwI	GGATC	4 cut(s)	5, 107, 179, 1095
Aor13HI	TCCGGA	1 cut(s)	67
AoxI	GGCC	3 cut(s)	146, 420, 972
ApeKI	GCWGC	1 cut(s)	469
ApoI	RAATTY	1 cut(s)	671
AsuHPI	GGTGA	2 cut(s)	943, 1082
BaeGI	GKGCMC	1 cut(s)	443
BaeI	ACNNNNGTAYC	2 cut(s)	534, 567
BalI	TGGCCA	1 cut(s)	148
BanII	GRGCYC	1 cut(s)	561
Bbv12I	GWGCWC	1 cut(s)	1071
BbvI	GCAGC	1 cut(s)	481
BccI	CCATC	2 cut(s)	157, 922
BceAI	ACGGC	2 cut(s)	251, 959
BciVI	GTATCC	1 cut(s)	535
BclI	TGATCA	1 cut(s)	916
BfaI	CTAG	2 cut(s)	164, 1094
BfmI	CTRYAG	1 cut(s)	810
BfuI	GTATCC	1 cut(s)	535
BglII	AGATCT	1 cut(s)	160
BisI	GCNGC	1 cut(s)	470
BlsI	GCNGC	1 cut(s)	471
BmgBI	CACGTC	1 cut(s)	588
BmiI	GGNNCC	1 cut(s)	1128
BmsI	GCATC	2 cut(s)	1106, 1126
BpuEI	CTTGAG	3 cut(s)	4, 224, 926
BsaBI	GATNNNNATC	2 cut(s)	117, 942
BsaJI	CCNNGG	3 cut(s)	267, 423, 1062
BsaWI	WCCGGW	1 cut(s)	67
BsaXI	ACNNNNNCTCC	2 cut(s)	1058, 1088
Bsc4I	CCNNNNNNNGG	2 cut(s)	724, 815
Bse1I	ACTGG	2 cut(s)	170, 798
Bse8I	GATNNNNATC	2 cut(s)	117, 942
BseAI	TCCGGA	1 cut(s)	67
BseDI	CCNNGG	3 cut(s)	267, 423, 1062
BseGI	GGATG	4 cut(s)	535, 541, 559, 772
BseJI	GATNNNNATC	2 cut(s)	117, 942
BseLI	CCNNNNNNNGG	2 cut(s)	724, 815
BseNI	ACTGG	2 cut(s)	170, 798
BseRI	GAGGAG	2 cut(s)	341, 806
BseSI	GKGCMC	1 cut(s)	443
BseXI	GCAGC	1 cut(s)	481
BshFI	GGCC	3 cut(s)	148, 422, 974
BsiHKAI	GWGCWC	1 cut(s)	1071
BsiSI	CCGG	2 cut(s)	68, 725
BslFI	GGGAC	3 cut(s)	86, 598, 999
BslI	CCNNNNNNNGG	2 cut(s)	724, 815
BsmFI	GGGAC	3 cut(s)	86, 598, 999
BsmI	GAATGC	1 cut(s)	509
BsnI	GGCC	3 cut(s)	148, 422, 974
Bsp1286I	GDGCHC	3 cut(s)	443, 561, 1071
Bsp13I	TCCGGA	1 cut(s)	67
Bsp1407I	TGTACA	1 cut(s)	214
Bsp143I	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
BspACI	CCGC	2 cut(s)	236, 331
BspANI	GGCC	3 cut(s)	148, 422, 974
BspEI	TCCGGA	1 cut(s)	67
BspHI	TCATGA	1 cut(s)	364
BspLI	GGNNCC	1 cut(s)	1128
BspPI	GGATC	4 cut(s)	5, 107, 179, 1095
BsrBI	CCGCTC	1 cut(s)	331
BsrGI	TGTACA	1 cut(s)	214
BsrI	ACTGG	2 cut(s)	170, 798
BssECI	CCNNGG	3 cut(s)	267, 423, 1062
BssMI	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
BssT1I	CCWWGG	2 cut(s)	423, 1062
Bst4CI	ACNGT	1 cut(s)	487
Bst6I	CTCTTC	5 cut(s)	61, 645, 783, 989, 1010
BstAPI	GCANNNNNTGC	1 cut(s)	1075
BstAUI	TGTACA	1 cut(s)	214
BstDEI	CTNAG	1 cut(s)	784
BstDSI	CCRYGG	1 cut(s)	267
BstF5I	GGATG	4 cut(s)	535, 541, 559, 772
BstKTI	GATC	7 cut(s)	13, 115, 163, 187, 754, 919, 1090
BstMBI	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
BstMWI	GCNNNNNNNGC	2 cut(s)	233, 1075
BstNSI	RCATGY	1 cut(s)	839
BstSFI	CTRYAG	1 cut(s)	810
BstSLI	GKGCMC	1 cut(s)	443
BstV1I	GCAGC	1 cut(s)	481
BstX2I	RGATCY	2 cut(s)	10, 160
BstYI	RGATCY	2 cut(s)	10, 160
BsuI	GTATCC	1 cut(s)	535
BsuRI	GGCC	3 cut(s)	148, 422, 974
BtgI	CCRYGG	1 cut(s)	267
BtrI	CACGTC	1 cut(s)	588
BtsCI	GGATG	4 cut(s)	535, 541, 559, 772
CciI	TCATGA	1 cut(s)	364
Csp6I	GTAC	4 cut(s)	167, 215, 428, 715
CviQI	GTAC	4 cut(s)	167, 215, 428, 715
DdeI	CTNAG	1 cut(s)	784
DpnI	GATC	7 cut(s)	12, 114, 162, 186, 753, 918, 1089
DpnII	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
EaeI	YGGCCR	2 cut(s)	146, 972
Eam1104I	CTCTTC	5 cut(s)	61, 645, 783, 989, 1010
EarI	CTCTTC	5 cut(s)	61, 645, 783, 989, 1010
Eco130I	CCWWGG	2 cut(s)	423, 1062
Eco24I	GRGCYC	1 cut(s)	561
EcoT14I	CCWWGG	2 cut(s)	423, 1062
EcoT22I	ATGCAT	1 cut(s)	511
EcoT38I	GRGCYC	1 cut(s)	561
ErhI	CCWWGG	2 cut(s)	423, 1062
FalI	AAGNNNNNCTT	2 cut(s)	888, 920
FaqI	GGGAC	3 cut(s)	86, 598, 999
FauI	CCCGC	1 cut(s)	324
FauNDI	CATATG	1 cut(s)	631
FbaI	TGATCA	1 cut(s)	916
Fnu4HI	GCNGC	1 cut(s)	470
FokI	GGATG	4 cut(s)	542, 548, 566, 779
FriOI	GRGCYC	1 cut(s)	561
Fsp4HI	GCNGC	1 cut(s)	470
FspBI	CTAG	2 cut(s)	164, 1094
GluI	GCNGC	1 cut(s)	470
HaeIII	GGCC	3 cut(s)	148, 422, 974
HapII	CCGG	2 cut(s)	68, 725
HincII	GTYRAC	1 cut(s)	375
HindII	GTYRAC	1 cut(s)	375
HindIII	AAGCTT	1 cut(s)	620
HinfI	GANTC	8 cut(s)	64, 134, 242, 356, 518, 653, 794, 964
HpaII	CCGG	2 cut(s)	68, 725
HphI	GGTGA	2 cut(s)	943, 1082
Hpy166II	GTNNAC	1 cut(s)	375
Hpy188I	TCNGA	1 cut(s)	955
Hpy188III	TCNNGA	6 cut(s)	68, 353, 365, 755, 905, 1145
Hpy8I	GTNNAC	1 cut(s)	375
HpyCH4III	ACNGT	1 cut(s)	487
HpyCH4IV	ACGT	1 cut(s)	587
HpyCH4V	TGCA	1 cut(s)	509
HpyF10VI	GCNNNNNNNGC	2 cut(s)	233, 1075
HpyF3I	CTNAG	1 cut(s)	784
HpySE526I	ACGT	1 cut(s)	587
Kpn2I	TCCGGA	1 cut(s)	67
Ksp22I	TGATCA	1 cut(s)	916
Kzo9I	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
LmnI	GCTCC	2 cut(s)	328, 1066
LpnPI	CCDG	6 cut(s)	81, 183, 305, 738, 811, 861
Lsp1109I	GCAGC	1 cut(s)	481
LweI	GCATC	2 cut(s)	1106, 1126
MaeI	CTAG	2 cut(s)	164, 1094
MaeII	ACGT	1 cut(s)	587
MaeIII	GTNAC	3 cut(s)	481, 603, 1057
MalI	GATC	7 cut(s)	12, 114, 162, 186, 753, 918, 1089
MbiI	CCGCTC	1 cut(s)	331
MboI	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
MfeI	CAATTG	1 cut(s)	210
MflI	RGATCY	2 cut(s)	10, 160
MhlI	GDGCHC	3 cut(s)	443, 561, 1071
MlsI	TGGCCA	1 cut(s)	148
MluCI	AATT	8 cut(s)	210, 297, 304, 522, 573, 671, 825, 949
MluNI	TGGCCA	1 cut(s)	148
MlyI	GAGTC	4 cut(s)	365, 527, 662, 803
MmeI	TCCRAC	1 cut(s)	20
Mox20I	TGGCCA	1 cut(s)	148
Mph1103I	ATGCAT	1 cut(s)	511
MroI	TCCGGA	1 cut(s)	67
MscI	TGGCCA	1 cut(s)	148
MseI	TTAA	2 cut(s)	681, 1156
MslI	CAYNNNNRTG	2 cut(s)	142, 708
Msp20I	TGGCCA	1 cut(s)	148
MspI	CCGG	2 cut(s)	68, 725
MunI	CAATTG	1 cut(s)	210
Mva1269I	GAATGC	1 cut(s)	509
MwoI	GCNNNNNNNGC	2 cut(s)	233, 1075
NdeI	CATATG	1 cut(s)	631
NdeII	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
NlaIV	GGNNCC	1 cut(s)	1128
NmuCI	GTSAC	2 cut(s)	481, 603
NsiI	ATGCAT	1 cut(s)	511
NspI	RCATGY	1 cut(s)	839
OliI	CACNNNNGTG	1 cut(s)	142
PagI	TCATGA	1 cut(s)	364
PctI	GAATGC	1 cut(s)	509
PfeI	GAWTC	4 cut(s)	64, 134, 242, 964
PkrI	GCNGC	1 cut(s)	471
PleI	GAGTC	4 cut(s)	364, 526, 661, 802
PpsI	GAGTC	4 cut(s)	364, 526, 661, 802
PspN4I	GGNNCC	1 cut(s)	1128
PsuI	RGATCY	2 cut(s)	10, 160
RsaI	GTAC	4 cut(s)	168, 216, 429, 716
RsaNI	GTAC	4 cut(s)	167, 215, 428, 715
RseI	CAYNNNNRTG	2 cut(s)	142, 708
SaqAI	TTAA	2 cut(s)	681, 1156
SatI	GCNGC	1 cut(s)	470
Sau3AI	GATC	7 cut(s)	10, 112, 160, 184, 751, 916, 1087
SchI	GAGTC	4 cut(s)	365, 527, 662, 803
SduI	GDGCHC	3 cut(s)	443, 561, 1071
SfaNI	GCATC	2 cut(s)	1106, 1126
SfcI	CTRYAG	1 cut(s)	810
SmiMI	CAYNNNNRTG	2 cut(s)	142, 708
SmlI	CTYRAG	3 cut(s)	19, 203, 905
SmoI	CTYRAG	3 cut(s)	19, 203, 905
Sse9I	AATT	8 cut(s)	210, 297, 304, 522, 573, 671, 825, 949
SsiI	CCGC	2 cut(s)	236, 331
SspI	AATATT	3 cut(s)	130, 277, 344
SspMI	CTAG	2 cut(s)	164, 1094
StyI	CCWWGG	2 cut(s)	423, 1062
TaaI	ACNGT	1 cut(s)	487
TaiI	ACGT	1 cut(s)	590
TaqI	TCGA	1 cut(s)	869
TasI	AATT	8 cut(s)	210, 297, 304, 522, 573, 671, 825, 949
TatI	WGTACW	1 cut(s)	214
TfiI	GAWTC	4 cut(s)	64, 134, 242, 964
Tru1I	TTAA	2 cut(s)	681, 1156
Tru9I	TTAA	2 cut(s)	681, 1156
TseFI	GTSAC	2 cut(s)	481, 603
TseI	GCWGC	1 cut(s)	469
Tsp45I	GTSAC	2 cut(s)	481, 603
TspDTI	ATGAA	6 cut(s)	48, 206, 579, 648, 692, 954
XapI	RAATTY	1 cut(s)	671
XceI	RCATGY	1 cut(s)	839
XcmI	CCANNNNNNNNNTGG	1 cut(s)	430
XspI	CTAG	2 cut(s)	164, 1094
Zsp2I	ATGCAT	1 cut(s)	511

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.