Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002460.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Reverse (-)

111511 .. 112386

Gene Structure 876 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002460.1_g000030.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 876 bp

atgactaatactgcttcttcttgcatacagagcatgaaatcttatacacaaaatattgaagaatctgttgagaagattgggcaatatgtggagataattttggtctgcttgaatcaagagtcaagagagtcagaaccaattcaagagctttcaacaattgaggaggatgattggctggcagttaatgagatttgggagagcgcattacctcaagagaactgtcctacacatatgacaactctatgggagccccctacagccactgtgttgcttcaatctcatgatacatcacgtgactcattcttagatgaggatgaagactacatcatccactacacaaccgagcttgaagcgttggaggaggaagatccctttgatgataaggggttttataatgaagaaagtaaggaagagctttatgagaatgagttcaatgtgccggaagcaatcacaatacctcatgatgatcaagagtgtttcaatgatgatacgggtgatttcttagaagaggagaccattaaatcacctatcatcgggcctttatctctagcacatggcacaccacttgattctcccttgccatattcgagctctacaaatgtttcttccatccaagaaatcattgattttgtcgatcatgtggagatggtcatttgcgagcatttgacatctgataaggagatccttctatccatgcttggtggatctcctaggagatggagacaatggaagaagagaaagaaaaagaggataatccaatcccatgtttccattactcccaagctacccaagttgttatcaagagatcatgaaacttcacttaaaagggttaagcatttgagggatccaagaccaaaacctcctgattactcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

291

Amino Acids

33.58

Weight (kDa)

4.53

Isoelectric Point (pI)

69.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	393
AclWI	GGATC	5 cut(s)	362, 676, 712, 839, 852
AcvI	CACGTG	1 cut(s)	293
AfiI	CCNNNNNNNGG	1 cut(s)	533
AgsI	TTSAA	8 cut(s)	59, 112, 143, 153, 275, 350, 433, 481
AluBI	AGCT	5 cut(s)	148, 346, 415, 591, 784
AluI	AGCT	5 cut(s)	148, 346, 415, 591, 784
Alw21I	GWGCWC	1 cut(s)	593
Alw26I	GTCTC	2 cut(s)	506, 715
AlwI	GGATC	5 cut(s)	362, 676, 712, 839, 852
AlwNI	CAGNNNCTG	1 cut(s)	263
AoxI	GGCC	1 cut(s)	536
Asp700I	GAANNNNTTC	2 cut(s)	138, 428
AspA2I	CCTAGG	1 cut(s)	710
AspLEI	GCGC	1 cut(s)	203
AspS9I	GGNCC	1 cut(s)	536
AsuHPI	GGTGA	2 cut(s)	506, 516
AvrII	CCTAGG	1 cut(s)	710
BamHI	GGATCC	1 cut(s)	844
BanII	GRGCYC	2 cut(s)	252, 593
BbrPI	CACGTG	1 cut(s)	293
BbsI	GAAGAC	1 cut(s)	324
Bbv12I	GWGCWC	1 cut(s)	593
BccI	CCATC	3 cut(s)	617, 640, 711
BclI	TGATCA	1 cut(s)	466
BcoDI	GTCTC	2 cut(s)	506, 715
BfaI	CTAG	2 cut(s)	548, 711
BfmI	CTRYAG	1 cut(s)	255
BlnI	CCTAGG	1 cut(s)	710
BmgT120I	GGNCC	1 cut(s)	536
BmiI	GGNNCC	2 cut(s)	249, 846
BpiI	GAAGAC	1 cut(s)	324
BpuEI	CTTGAG	1 cut(s)	195
BsaAI	YACGTR	1 cut(s)	293
BsaI	GGTCTC	1 cut(s)	506
BsaJI	CCNNGG	1 cut(s)	710
Bsc4I	CCNNNNNNNGG	1 cut(s)	533
BseDI	CCNNGG	1 cut(s)	710
BseGI	GGATG	4 cut(s)	172, 319, 327, 609
BseLI	CCNNNNNNNGG	1 cut(s)	533
BseRI	GAGGAG	3 cut(s)	176, 374, 524
BshFI	GGCC	1 cut(s)	538
BsiHKAI	GWGCWC	1 cut(s)	593
BsiSI	CCGG	1 cut(s)	440
BslI	CCNNNNNNNGG	1 cut(s)	533
BsmAI	GTCTC	2 cut(s)	506, 715
BsnI	GGCC	1 cut(s)	538
Bso31I	GGTCTC	1 cut(s)	506
Bsp1286I	GDGCHC	2 cut(s)	252, 593
Bsp143I	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
BspANI	GGCC	1 cut(s)	538
BspHI	TCATGA	3 cut(s)	280, 460, 808
BspLI	GGNNCC	2 cut(s)	249, 846
BspPI	GGATC	5 cut(s)	362, 676, 712, 839, 852
BspQI	GCTCTTC	1 cut(s)	405
BspTNI	GGTCTC	1 cut(s)	506
BssECI	CCNNGG	1 cut(s)	710
BssMI	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
BssT1I	CCWWGG	1 cut(s)	710
Bst4CI	ACNGT	2 cut(s)	221, 265
Bst6I	CTCTTC	3 cut(s)	405, 501, 728
BstBAI	YACGTR	1 cut(s)	293
BstC8I	GCNNGC	2 cut(s)	177, 659
BstDEI	CTNAG	2 cut(s)	304, 502
BstF5I	GGATG	4 cut(s)	172, 319, 327, 609
BstHHI	GCGC	1 cut(s)	203
BstKTI	GATC	7 cut(s)	370, 469, 637, 684, 707, 808, 847
BstMAI	GTCTC	2 cut(s)	506, 715
BstMBI	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
BstMWI	GCNNNNNNNGC	1 cut(s)	30
BstSFI	CTRYAG	1 cut(s)	255
BstV2I	GAAGAC	1 cut(s)	324
BstX2I	RGATCY	4 cut(s)	367, 681, 704, 844
BstYI	RGATCY	4 cut(s)	367, 681, 704, 844
BsuRI	GGCC	1 cut(s)	538
BtsCI	GGATG	4 cut(s)	172, 319, 327, 609
BtsIMutI	CAGTG	1 cut(s)	261
Cac8I	GCNNGC	2 cut(s)	177, 659
CaiI	CAGNNNCTG	1 cut(s)	263
CciI	TCATGA	3 cut(s)	280, 460, 808
CfoI	GCGC	1 cut(s)	203
Cfr13I	GGNCC	1 cut(s)	536
CviAII	CATG	8 cut(s)	34, 281, 461, 554, 638, 694, 764, 809
CviJI	RGCY	9 cut(s)	148, 175, 250, 260, 346, 415, 538, 591, 784
CviKI_1	RGCY	9 cut(s)	148, 175, 250, 260, 346, 415, 538, 591, 784
DdeI	CTNAG	2 cut(s)	304, 502
DpnI	GATC	7 cut(s)	369, 468, 636, 683, 706, 807, 846
DpnII	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
Eam1104I	CTCTTC	3 cut(s)	405, 501, 728
EarI	CTCTTC	3 cut(s)	405, 501, 728
Ecl136II	GAGCTC	1 cut(s)	591
Eco130I	CCWWGG	1 cut(s)	710
Eco24I	GRGCYC	2 cut(s)	252, 593
Eco31I	GGTCTC	1 cut(s)	506
Eco53kI	GAGCTC	1 cut(s)	591
Eco72I	CACGTG	1 cut(s)	293
EcoICRI	GAGCTC	1 cut(s)	591
EcoT14I	CCWWGG	1 cut(s)	710
EcoT38I	GRGCYC	2 cut(s)	252, 593
ErhI	CCWWGG	1 cut(s)	710
FaeI	CATG	8 cut(s)	37, 284, 464, 557, 641, 697, 767, 812
FatI	CATG	8 cut(s)	33, 280, 460, 553, 637, 693, 763, 808
FauNDI	CATATG	1 cut(s)	231
FbaI	TGATCA	1 cut(s)	466
FokI	GGATG	4 cut(s)	179, 314, 326, 596
FriOI	GRGCYC	2 cut(s)	252, 593
FspBI	CTAG	2 cut(s)	548, 711
GlaI	GCGC	1 cut(s)	202
HaeIII	GGCC	1 cut(s)	538
HapII	CCGG	1 cut(s)	440
HhaI	GCGC	1 cut(s)	203
Hin1II	CATG	8 cut(s)	37, 284, 464, 557, 641, 697, 767, 812
Hin6I	GCGC	1 cut(s)	201
HinP1I	GCGC	1 cut(s)	201
HinfI	GANTC	6 cut(s)	62, 112, 119, 128, 296, 569
HpaII	CCGG	1 cut(s)	440
HphI	GGTGA	2 cut(s)	506, 516
Hpy188I	TCNGA	2 cut(s)	133, 673
HpyAV	CCTTC	1 cut(s)	695
HpyCH4III	ACNGT	2 cut(s)	221, 265
HpyCH4IV	ACGT	1 cut(s)	292
HpyCH4V	TGCA	1 cut(s)	24
HpyF10VI	GCNNNNNNNGC	1 cut(s)	30
HpyF3I	CTNAG	2 cut(s)	304, 502
HpySE526I	ACGT	1 cut(s)	292
Hsp92II	CATG	8 cut(s)	37, 284, 464, 557, 641, 697, 767, 812
HspAI	GCGC	1 cut(s)	201
Ksp22I	TGATCA	1 cut(s)	466
Kzo9I	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
LguI	GCTCTTC	1 cut(s)	405
LmnI	GCTCC	1 cut(s)	247
LpnPI	CCDG	2 cut(s)	161, 453
MaeI	CTAG	2 cut(s)	548, 711
MaeII	ACGT	1 cut(s)	292
MaeIII	GTNAC	1 cut(s)	293
MalI	GATC	7 cut(s)	369, 468, 636, 683, 706, 807, 846
MboI	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
MfeI	CAATTG	1 cut(s)	156
MflI	RGATCY	4 cut(s)	367, 681, 704, 844
MhlI	GDGCHC	2 cut(s)	252, 593
MluCI	AATT	3 cut(s)	96, 138, 156
MlyI	GAGTC	3 cut(s)	128, 137, 290
MmeI	TCCRAC	1 cut(s)	336
MroXI	GAANNNNTTC	2 cut(s)	138, 428
MseI	TTAA	4 cut(s)	183, 519, 822, 831
MspI	CCGG	1 cut(s)	440
MunI	CAATTG	1 cut(s)	156
MwoI	GCNNNNNNNGC	1 cut(s)	30
NdeI	CATATG	1 cut(s)	231
NdeII	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
NlaIII	CATG	8 cut(s)	37, 284, 464, 557, 641, 697, 767, 812
NlaIV	GGNNCC	2 cut(s)	249, 846
NmuCI	GTSAC	1 cut(s)	293
PagI	TCATGA	3 cut(s)	280, 460, 808
PciSI	GCTCTTC	1 cut(s)	405
PdmI	GAANNNNTTC	2 cut(s)	138, 428
PfeI	GAWTC	3 cut(s)	62, 112, 569
PleI	GAGTC	3 cut(s)	127, 136, 290
PmaCI	CACGTG	1 cut(s)	293
PmlI	CACGTG	1 cut(s)	293
PpsI	GAGTC	3 cut(s)	127, 136, 290
Ppu21I	YACGTR	1 cut(s)	293
PsiI	TTATAA	1 cut(s)	393
Psp124BI	GAGCTC	1 cut(s)	593
PspCI	CACGTG	1 cut(s)	293
PspN4I	GGNNCC	2 cut(s)	249, 846
PspPI	GGNCC	1 cut(s)	536
PstNI	CAGNNNCTG	1 cut(s)	263
PsuI	RGATCY	4 cut(s)	367, 681, 704, 844
SacI	GAGCTC	1 cut(s)	593
SapI	GCTCTTC	1 cut(s)	405
SaqAI	TTAA	4 cut(s)	183, 519, 822, 831
Sau3AI	GATC	7 cut(s)	367, 466, 634, 681, 704, 805, 844
Sau96I	GGNCC	1 cut(s)	536
SchI	GAGTC	3 cut(s)	128, 137, 290
SduI	GDGCHC	2 cut(s)	252, 593
SfcI	CTRYAG	1 cut(s)	255
SmlI	CTYRAG	1 cut(s)	210
SmoI	CTYRAG	1 cut(s)	210
Sse9I	AATT	3 cut(s)	96, 138, 156
SspI	AATATT	1 cut(s)	55
SspMI	CTAG	2 cut(s)	548, 711
SstI	GAGCTC	1 cut(s)	593
StyI	CCWWGG	1 cut(s)	710
TaaI	ACNGT	2 cut(s)	221, 265
TaiI	ACGT	1 cut(s)	295
TaqI	TCGA	2 cut(s)	587, 633
TasI	AATT	3 cut(s)	96, 138, 156
TfiI	GAWTC	3 cut(s)	62, 112, 569
Tru1I	TTAA	4 cut(s)	183, 519, 822, 831
Tru9I	TTAA	4 cut(s)	183, 519, 822, 831
TscAI	CASTG	1 cut(s)	268
TseFI	GTSAC	1 cut(s)	293
Tsp45I	GTSAC	1 cut(s)	293
TspDTI	ATGAA	4 cut(s)	50, 330, 411, 825
TspRI	CASTG	1 cut(s)	268
XmaJI	CCTAGG	1 cut(s)	710
XmnI	GAANNNNTTC	2 cut(s)	138, 428
XspI	CTAG	2 cut(s)	548, 711

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.