Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009305.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 584

Gene Structure 584 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009305.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 584 bp

ttcaagcttggattcaggaaaagcaagctcttgatgatgatttggcagaaaaactaaagcgtttggagaacttaatatctcgggagcaccattctaaaccgatggcaactttaggggagctcccaacaactacggctttgtgtcaacctcatgatgcagtccatgattcaacatttgatgaggatgaagtaatggatttggaggagtcttataaagtgccactcaactttgagatttttgaggatcactacatgaccgagcttgaaaagtgggaaatggaagatgcctttgatgatgaggaatcctatcatgaagaaagtaaggatgagcttcatgcaaatgtgccccaagtgcctgaaacaatcatgttacctaatgaagatccaaaaggatatgaggccacaagggaggattgcttaaaagaggagtccatcaaagctcctacatttaggcctttattgctagcacatggaagatcatctgatccttcaacacctcattcaagctctacacatgttctccccatccaagcaaagtttgagtttgttgatcatgtggagatggtgagatctcaaatcacataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

193

Amino Acids

22.29

Weight (kDa)

4.52

Isoelectric Point (pI)

54.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	212
AclWI	GGATC	3 cut(s)	251, 376, 478
AflIII	ACRYGT	1 cut(s)	513
AgsI	TTSAA	5 cut(s)	4, 170, 265, 491, 503
AluBI	AGCT	7 cut(s)	7, 28, 120, 261, 330, 439, 506
AluI	AGCT	7 cut(s)	7, 28, 120, 261, 330, 439, 506
Alw21I	GWGCWC	2 cut(s)	89, 122
AlwI	GGATC	3 cut(s)	251, 376, 478
Ama87I	CYCGRG	1 cut(s)	80
AoxI	GGCC	2 cut(s)	398, 451
AsuHPI	GGTGA	1 cut(s)	576
AsuNHI	GCTAGC	1 cut(s)	462
AvaI	CYCGRG	1 cut(s)	80
BaeGI	GKGCMC	1 cut(s)	347
BanII	GRGCYC	1 cut(s)	122
Bbv12I	GWGCWC	2 cut(s)	89, 122
BccI	CCATC	4 cut(s)	96, 439, 532, 555
BceAI	ACGGC	1 cut(s)	149
BclI	TGATCA	1 cut(s)	549
BfaI	CTAG	1 cut(s)	463
BglII	AGATCT	1 cut(s)	568
BmeT110I	CYCGRG	1 cut(s)	80
BmsI	GCATC	2 cut(s)	144, 273
BmtI	GCTAGC	1 cut(s)	466
BsaXI	ACNNNNNCTCC	2 cut(s)	503, 533
BseGI	GGATG	3 cut(s)	189, 330, 524
BseRI	GAGGAG	2 cut(s)	217, 439
BseSI	GKGCMC	1 cut(s)	347
BshFI	GGCC	2 cut(s)	400, 453
BsiHKAI	GWGCWC	2 cut(s)	89, 122
BsiHKCI	CYCGRG	1 cut(s)	80
BsnI	GGCC	2 cut(s)	400, 453
BsoBI	CYCGRG	1 cut(s)	80
Bsp1286I	GDGCHC	3 cut(s)	89, 122, 347
Bsp143I	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
BspANI	GGCC	2 cut(s)	400, 453
BspHI	TCATGA	2 cut(s)	150, 309
BspOI	GCTAGC	1 cut(s)	466
BspPI	GGATC	3 cut(s)	251, 376, 478
BssMI	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
BstC8I	GCNNGC	2 cut(s)	26, 464
BstF5I	GGATG	3 cut(s)	189, 330, 524
BstKTI	GATC	6 cut(s)	246, 384, 478, 486, 552, 571
BstMBI	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
BstMWI	GCNNNNNNNGC	2 cut(s)	351, 459
BstNSI	RCATGY	1 cut(s)	517
BstSLI	GKGCMC	1 cut(s)	347
BstX2I	RGATCY	2 cut(s)	381, 568
BstYI	RGATCY	2 cut(s)	381, 568
BsuRI	GGCC	2 cut(s)	400, 453
BtsCI	GGATG	3 cut(s)	189, 330, 524
Cac8I	GCNNGC	2 cut(s)	26, 464
CciI	TCATGA	2 cut(s)	150, 309
CviAII	CATG	9 cut(s)	151, 163, 252, 310, 334, 366, 469, 514, 553
DpnI	GATC	6 cut(s)	245, 383, 477, 485, 551, 570
DpnII	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
Ecl136II	GAGCTC	1 cut(s)	120
Eco147I	AGGCCT	1 cut(s)	453
Eco24I	GRGCYC	1 cut(s)	122
Eco53kI	GAGCTC	1 cut(s)	120
Eco88I	CYCGRG	1 cut(s)	80
EcoICRI	GAGCTC	1 cut(s)	120
EcoT38I	GRGCYC	1 cut(s)	122
FaeI	CATG	9 cut(s)	154, 166, 255, 313, 337, 369, 472, 517, 556
FatI	CATG	9 cut(s)	150, 162, 251, 309, 333, 365, 468, 513, 552
FbaI	TGATCA	1 cut(s)	549
FokI	GGATG	3 cut(s)	196, 337, 511
FriOI	GRGCYC	1 cut(s)	122
FspBI	CTAG	1 cut(s)	463
HaeIII	GGCC	2 cut(s)	400, 453
Hin1II	CATG	9 cut(s)	154, 166, 255, 313, 337, 369, 472, 517, 556
HincII	GTYRAC	1 cut(s)	145
HindII	GTYRAC	1 cut(s)	145
HindIII	AAGCTT	1 cut(s)	5
HinfI	GANTC	5 cut(s)	12, 166, 205, 301, 427
HphI	GGTGA	1 cut(s)	576
Hpy166II	GTNNAC	1 cut(s)	145
Hpy188I	TCNGA	1 cut(s)	483
Hpy188III	TCNNGA	5 cut(s)	16, 31, 82, 151, 310
Hpy8I	GTNNAC	1 cut(s)	145
HpyAV	CCTTC	1 cut(s)	497
HpyCH4V	TGCA	2 cut(s)	157, 337
HpyF10VI	GCNNNNNNNGC	2 cut(s)	351, 459
Hsp92II	CATG	9 cut(s)	154, 166, 255, 313, 337, 369, 472, 517, 556
Ksp22I	TGATCA	1 cut(s)	549
Kzo9I	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
LmnI	GCTCC	4 cut(s)	84, 117, 125, 444
LpnPI	CCDG	1 cut(s)	368
LweI	GCATC	2 cut(s)	144, 273
MaeI	CTAG	1 cut(s)	463
MaeIII	GTNAC	1 cut(s)	368
MalI	GATC	6 cut(s)	245, 383, 477, 485, 551, 570
MboI	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
MboII	GAAGA	4 cut(s)	292, 325, 391, 485
MflI	RGATCY	2 cut(s)	381, 568
MhlI	GDGCHC	3 cut(s)	89, 122, 347
MlyI	GAGTC	2 cut(s)	214, 436
MnlI	CCTC	9 cut(s)	158, 174, 195, 234, 291, 390, 402, 417, 506
MseI	TTAA	2 cut(s)	73, 418
MslI	CAYNNNNRTG	1 cut(s)	338
MwoI	GCNNNNNNNGC	2 cut(s)	351, 459
NdeII	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
NheI	GCTAGC	1 cut(s)	462
NlaIII	CATG	9 cut(s)	154, 166, 255, 313, 337, 369, 472, 517, 556
NspI	RCATGY	1 cut(s)	517
PagI	TCATGA	2 cut(s)	150, 309
PceI	AGGCCT	1 cut(s)	453
PciI	ACATGT	1 cut(s)	513
PfeI	GAWTC	3 cut(s)	12, 166, 301
PleI	GAGTC	2 cut(s)	213, 435
PpsI	GAGTC	2 cut(s)	213, 435
PscI	ACATGT	1 cut(s)	513
PsiI	TTATAA	1 cut(s)	212
Psp124BI	GAGCTC	1 cut(s)	122
PsuI	RGATCY	2 cut(s)	381, 568
RseI	CAYNNNNRTG	1 cut(s)	338
SacI	GAGCTC	1 cut(s)	122
SaqAI	TTAA	2 cut(s)	73, 418
Sau3AI	GATC	6 cut(s)	243, 381, 475, 483, 549, 568
SchI	GAGTC	2 cut(s)	214, 436
SduI	GDGCHC	3 cut(s)	89, 122, 347
SfaNI	GCATC	2 cut(s)	144, 273
SmiMI	CAYNNNNRTG	1 cut(s)	338
SseBI	AGGCCT	1 cut(s)	453
SspMI	CTAG	1 cut(s)	463
SstI	GAGCTC	1 cut(s)	122
StuI	AGGCCT	1 cut(s)	453
TaqII	GACCGA	1 cut(s)	271
TfiI	GAWTC	3 cut(s)	12, 166, 301
Tru1I	TTAA	2 cut(s)	73, 418
Tru9I	TTAA	2 cut(s)	73, 418
TspDTI	ATGAA	4 cut(s)	200, 322, 326, 392
XceI	RCATGY	1 cut(s)	517
XspI	CTAG	1 cut(s)	463

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.