Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022803.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 3349

Gene Structure 3349 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022803.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 837 bp

atgcttggaggatttcatgacaaccaagggcattggaataattattattcacctccataccattcggcatgggatcatcctccttactcttcgtggaatgacgatccaaacatgcaacaaggatctttcaatgagttcgaagcttccccatattcataccatgactattgtccacaagccccacctcctcaaaactcaggacaacaagcttcagatgcttcttttcaagcttggattcaggaaaagcaagctcttgatgatgatttggcagaaaagctaaagcgtttggagaacttaatatctcaggagcacccttctaaaccgatggaaactttagaggagctctcgacaactacagatttgtgccaaccccatgatgcattccatgattcaacatttgatgaggatgtagtaagagatttggatgagtcttacgaagagccactcaacgttgagatttttgaggatcactacatgaccgagcttgaaaagtgggaaatggaagatccgtttgatgatgatgaatcctataatgaaggaagtaaggatgaacttcatgcaaatgtgccccaagtgcctgaaacaatcatgttacctaatgaagatccaaaaggatatgaggccacaagggaggattgcttaaaagaggagtccatcaaagctcctacatttggacctttattgctagcacatggaagaccatctgatcctacaatgcctcattcaacatctacacatgttctcaccatccaagcaacttttgagtttgttgatcatgtggagatggtcataagtgaacatctcaaatcacataaggagatcattgtagccgtgatt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

279

Amino Acids

32.05

Weight (kDa)

4.33

Isoelectric Point (pI)

49.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	450
AclWI	GGATC	7 cut(s)	81, 98, 130, 474, 500, 599, 701
AcuI	CTGAAG	1 cut(s)	195
AfiI	CCNNNNNNNGG	1 cut(s)	671
AflIII	ACRYGT	1 cut(s)	736
AgsI	TTSAA	5 cut(s)	130, 227, 393, 488, 726
AluBI	AGCT	8 cut(s)	143, 209, 230, 251, 277, 343, 484, 662
AluI	AGCT	8 cut(s)	143, 209, 230, 251, 277, 343, 484, 662
Alw21I	GWGCWC	2 cut(s)	312, 345
AlwI	GGATC	7 cut(s)	81, 98, 130, 474, 500, 599, 701
AoxI	GGCC	1 cut(s)	621
AspS9I	GGNCC	1 cut(s)	674
AsuHPI	GGTGA	2 cut(s)	42, 736
AsuII	TTCGAA	1 cut(s)	138
AsuNHI	GCTAGC	1 cut(s)	685
AvaII	GGWCC	1 cut(s)	674
BaeGI	GKGCMC	1 cut(s)	570
BanII	GRGCYC	1 cut(s)	345
BbsI	GAAGAC	1 cut(s)	703
Bbv12I	GWGCWC	2 cut(s)	312, 345
BccI	CCATC	5 cut(s)	319, 662, 709, 755, 778
BceAI	ACGGC	1 cut(s)	815
BclI	TGATCA	1 cut(s)	772
BfaI	CTAG	1 cut(s)	686
BfmI	CTRYAG	1 cut(s)	354
Bme18I	GGWCC	1 cut(s)	674
BmgT120I	GGNCC	1 cut(s)	674
BmsI	GCATC	2 cut(s)	205, 367
BmtI	GCTAGC	1 cut(s)	689
BoxI	GACNNNNGTC	1 cut(s)	168
BpiI	GAAGAC	1 cut(s)	703
BplI	GAGNNNNNCTC	2 cut(s)	329, 361
Bpu14I	TTCGAA	1 cut(s)	138
BsaJI	CCNNGG	1 cut(s)	25
Bsc4I	CCNNNNNNNGG	1 cut(s)	671
BseDI	CCNNGG	1 cut(s)	25
BseGI	GGATG	5 cut(s)	76, 412, 430, 553, 747
BseLI	CCNNNNNNNGG	1 cut(s)	671
BseMII	CTCAG	2 cut(s)	210, 317
BseRI	GAGGAG	3 cut(s)	177, 353, 662
BseSI	GKGCMC	1 cut(s)	570
BshFI	GGCC	1 cut(s)	623
BsiHKAI	GWGCWC	2 cut(s)	312, 345
BslI	CCNNNNNNNGG	1 cut(s)	671
BsmI	GAATGC	1 cut(s)	380
BsnI	GGCC	1 cut(s)	623
Bsp119I	TTCGAA	1 cut(s)	138
Bsp1286I	GDGCHC	3 cut(s)	312, 345, 570
Bsp143I	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
BspANI	GGCC	1 cut(s)	623
BspCNI	CTCAG	2 cut(s)	209, 316
BspHI	TCATGA	1 cut(s)	16
BspOI	GCTAGC	1 cut(s)	689
BspPI	GGATC	7 cut(s)	81, 98, 130, 474, 500, 599, 701
BspQI	GCTCTTC	1 cut(s)	432
BspT104I	TTCGAA	1 cut(s)	138
BssECI	CCNNGG	1 cut(s)	25
BssMI	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
BssT1I	CCWWGG	1 cut(s)	25
Bst6I	CTCTTC	2 cut(s)	94, 432
BstBI	TTCGAA	1 cut(s)	138
BstC8I	GCNNGC	2 cut(s)	249, 687
BstDEI	CTNAG	2 cut(s)	196, 303
BstF5I	GGATG	5 cut(s)	76, 412, 430, 553, 747
BstKTI	GATC	9 cut(s)	76, 106, 125, 469, 508, 607, 709, 775, 822
BstMBI	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
BstMWI	GCNNNNNNNGC	2 cut(s)	215, 574
BstNSI	RCATGY	2 cut(s)	115, 740
BstPAI	GACNNNNGTC	1 cut(s)	168
BstSFI	CTRYAG	1 cut(s)	354
BstSLI	GKGCMC	1 cut(s)	570
BstV2I	GAAGAC	1 cut(s)	703
BstX2I	RGATCY	3 cut(s)	122, 505, 604
BstYI	RGATCY	3 cut(s)	122, 505, 604
BsuRI	GGCC	1 cut(s)	623
BtsCI	GGATG	5 cut(s)	76, 412, 430, 553, 747
Cac8I	GCNNGC	2 cut(s)	249, 687
CciI	TCATGA	1 cut(s)	16
Cfr13I	GGNCC	1 cut(s)	674
DdeI	CTNAG	2 cut(s)	196, 303
DpnI	GATC	9 cut(s)	75, 105, 124, 468, 507, 606, 708, 774, 821
DpnII	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
Eam1104I	CTCTTC	2 cut(s)	94, 432
EarI	CTCTTC	2 cut(s)	94, 432
Ecl136II	GAGCTC	1 cut(s)	343
Eco130I	CCWWGG	1 cut(s)	25
Eco24I	GRGCYC	1 cut(s)	345
Eco47I	GGWCC	1 cut(s)	674
Eco53kI	GAGCTC	1 cut(s)	343
Eco57I	CTGAAG	1 cut(s)	195
EcoICRI	GAGCTC	1 cut(s)	343
EcoT14I	CCWWGG	1 cut(s)	25
EcoT22I	ATGCAT	1 cut(s)	382
EcoT38I	GRGCYC	1 cut(s)	345
ErhI	CCWWGG	1 cut(s)	25
FbaI	TGATCA	1 cut(s)	772
FokI	GGATG	5 cut(s)	63, 419, 437, 560, 734
FriOI	GRGCYC	1 cut(s)	345
FspBI	CTAG	1 cut(s)	686
HaeIII	GGCC	1 cut(s)	623
HindIII	AAGCTT	3 cut(s)	141, 207, 228
HinfI	GANTC	5 cut(s)	235, 389, 428, 524, 650
HphI	GGTGA	2 cut(s)	42, 736
Hpy166II	GTNNAC	2 cut(s)	173, 797
Hpy188I	TCNGA	2 cut(s)	214, 706
Hpy188III	TCNNGA	6 cut(s)	17, 198, 239, 254, 305, 346
Hpy8I	GTNNAC	2 cut(s)	173, 797
HpyAV	CCTTC	2 cut(s)	324, 530
HpyCH4IV	ACGT	1 cut(s)	450
HpyCH4V	TGCA	3 cut(s)	115, 380, 560
HpyF10VI	GCNNNNNNNGC	2 cut(s)	215, 574
HpyF3I	CTNAG	2 cut(s)	196, 303
HpySE526I	ACGT	1 cut(s)	450
Ksp22I	TGATCA	1 cut(s)	772
Kzo9I	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
LguI	GCTCTTC	1 cut(s)	432
LmnI	GCTCC	3 cut(s)	307, 340, 667
LpnPI	CCDG	4 cut(s)	183, 224, 290, 591
LweI	GCATC	2 cut(s)	205, 367
MaeI	CTAG	1 cut(s)	686
MaeII	ACGT	1 cut(s)	450
MaeIII	GTNAC	1 cut(s)	591
MalI	GATC	9 cut(s)	75, 105, 124, 468, 507, 606, 708, 774, 821
MboI	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
MboII	GAAGA	5 cut(s)	81, 449, 515, 614, 708
MflI	RGATCY	3 cut(s)	122, 505, 604
MhlI	GDGCHC	3 cut(s)	312, 345, 570
MluCI	AATT	1 cut(s)	40
MlyI	GAGTC	2 cut(s)	437, 659
Mph1103I	ATGCAT	1 cut(s)	382
MseI	TTAA	2 cut(s)	296, 641
MslI	CAYNNNNRTG	1 cut(s)	561
Mva1269I	GAATGC	1 cut(s)	380
MwoI	GCNNNNNNNGC	2 cut(s)	215, 574
NdeII	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
NheI	GCTAGC	1 cut(s)	685
NsiI	ATGCAT	1 cut(s)	382
NspI	RCATGY	2 cut(s)	115, 740
NspV	TTCGAA	1 cut(s)	138
PagI	TCATGA	1 cut(s)	16
PciI	ACATGT	1 cut(s)	736
PciSI	GCTCTTC	1 cut(s)	432
PctI	GAATGC	1 cut(s)	380
PfeI	GAWTC	3 cut(s)	235, 389, 524
PleI	GAGTC	2 cut(s)	436, 658
PpsI	GAGTC	2 cut(s)	436, 658
PscI	ACATGT	1 cut(s)	736
PshAI	GACNNNNGTC	1 cut(s)	168
Psp124BI	GAGCTC	1 cut(s)	345
Psp1406I	AACGTT	1 cut(s)	450
PspPI	GGNCC	1 cut(s)	674
PsuI	RGATCY	3 cut(s)	122, 505, 604
RseI	CAYNNNNRTG	1 cut(s)	561
SacI	GAGCTC	1 cut(s)	345
SapI	GCTCTTC	1 cut(s)	432
SaqAI	TTAA	2 cut(s)	296, 641
Sau3AI	GATC	9 cut(s)	73, 103, 122, 466, 505, 604, 706, 772, 819
Sau96I	GGNCC	1 cut(s)	674
SchI	GAGTC	2 cut(s)	437, 659
SduI	GDGCHC	3 cut(s)	312, 345, 570
SfaNI	GCATC	2 cut(s)	205, 367
SfcI	CTRYAG	1 cut(s)	354
SfuI	TTCGAA	1 cut(s)	138
SinI	GGWCC	1 cut(s)	674
SmiMI	CAYNNNNRTG	1 cut(s)	561
Sse9I	AATT	1 cut(s)	40
SspMI	CTAG	1 cut(s)	686
SstI	GAGCTC	1 cut(s)	345
StyI	CCWWGG	1 cut(s)	25
TaiI	ACGT	1 cut(s)	453
TaqI	TCGA	2 cut(s)	138, 347
TaqII	GACCGA	1 cut(s)	494
TasI	AATT	1 cut(s)	40
TfiI	GAWTC	3 cut(s)	235, 389, 524
Tru1I	TTAA	2 cut(s)	296, 641
Tru9I	TTAA	2 cut(s)	296, 641
TspDTI	ATGAA	7 cut(s)	5, 144, 537, 545, 549, 564, 615
TspGWI	ACGGA	1 cut(s)	498
VpaK11BI	GGWCC	1 cut(s)	674
XceI	RCATGY	2 cut(s)	115, 740
XspI	CTAG	1 cut(s)	686
Zsp2I	ATGCAT	1 cut(s)	382

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.