Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006648.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Reverse (-)

22643 .. 23806

Gene Structure 1164 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006648.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1164 bp

atgtgggaggatcccaacttaagcatttacaacaatggttggactaatgctaactcttcatggaatccggaagtgttcaactcatggcagccttatcaagtccctatgtatgatccttatcatcacaatattgattcattcatgtggccgtcataccaagagcaagcaccagtcctcttggttgatccaatgaagccctcccttgaggcaattgtacaggcagctgcgaaaagtgcggaagaatcatcaaggaatatggacaaagccgtggagaatattgagcaacatatccaacaaattattaattctttgaaccaagaaacagaggagcgggaaacacaatgttgggttcaagagtcatatcatgaggcgttgacgagtgaggaagaagattgggcagaagctaatgagcctttggaggccaaggtacttatggagtgccctcttacacctactacagctttagggcagtcccttgaagtcacagccttacctcaacctcaacctcataatgtattccatgagtcaattttggatgaggatgaggatacagatgtggatgagccttatgaaaagaaacttgaggttgagacatgtgaggattatgtgttacactataaaaccgagcttgaagcatatgaagatagtgatattgaagaatccctgacaggtgaggaattttacattaaagaaagtaaggttcaacttcatgcgaatgagtaccaagagccagaagcaatcatcatagctcataaagatcaagaatacaaggatgacatggaggattgcttagaagaggagtccaacaaatctcctatagatgggcctctaattctatcacatgcccgaccacctgaccattatttgccacattcgagctttacatttgttccctccatacaagaaactcttgagtttgttgatcatgtggagatggtgataggtgaatatcccaattttgataagaagattcttttggccgtgcttgtgggacataagaagagaacgagagaatggaagaagagaaacaaaacgagaaagttgaaatcctatctttccattgttaccaaggagcacaagttgcttaaaatgaatcacctagcatctttgaaaaaggtcaagcatctcatggaaccaagaccaaaacctcctgattactattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

387

Amino Acids

45.17

Weight (kDa)

4.69

Isoelectric Point (pI)

58.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	331
AccIII	TCCGGA	1 cut(s)	67
AciI	CCGC	2 cut(s)	236, 331
AclWI	GGATC	4 cut(s)	5, 18, 107, 179
AcoI	YGGCCR	2 cut(s)	146, 978
AcsI	RAATTY	1 cut(s)	677
AfaI	GTAC	3 cut(s)	216, 429, 722
AfiI	CCNNNNNNNGG	1 cut(s)	821
AflII	CTTAAG	1 cut(s)	19
AflIII	ACRYGT	1 cut(s)	593
AgsI	TTSAA	9 cut(s)	79, 313, 353, 479, 632, 656, 704, 1045, 1111
AjuI	GAANNNNNNNTTGG	2 cut(s)	959, 991
AluBI	AGCT	6 cut(s)	224, 404, 461, 628, 749, 879
AluI	AGCT	6 cut(s)	224, 404, 461, 628, 749, 879
Alw21I	GWGCWC	1 cut(s)	1077
Alw26I	GTCTC	1 cut(s)	584
AlwI	GGATC	4 cut(s)	5, 18, 107, 179
Aor13HI	TCCGGA	1 cut(s)	67
AoxI	GGCC	4 cut(s)	146, 420, 824, 978
ApeKI	GCWGC	3 cut(s)	88, 221, 224
ApoI	RAATTY	1 cut(s)	677
AseI	ATTAAT	1 cut(s)	303
AspS9I	GGNCC	1 cut(s)	824
AsuHPI	GGTGA	4 cut(s)	683, 949, 956, 1088
BaeGI	GKGCMC	1 cut(s)	443
BaeI	ACNNNNGTAYC	2 cut(s)	540, 573
BamHI	GGATCC	1 cut(s)	10
Bbv12I	GWGCWC	1 cut(s)	1077
BbvI	GCAGC	3 cut(s)	100, 211, 233
BccI	CCATC	2 cut(s)	815, 928
BceAI	ACGGC	3 cut(s)	133, 251, 965
BciVI	GTATCC	1 cut(s)	541
BclI	TGATCA	1 cut(s)	922
BcoDI	GTCTC	1 cut(s)	584
BfaI	CTAG	1 cut(s)	1100
BfmI	CTRYAG	2 cut(s)	456, 816
BfrI	CTTAAG	1 cut(s)	19
BfuI	GTATCC	1 cut(s)	541
BisI	GCNGC	3 cut(s)	89, 222, 225
BlsI	GCNGC	3 cut(s)	90, 223, 226
BmgT120I	GGNCC	1 cut(s)	824
BmiI	GGNNCC	2 cut(s)	12, 1134
BmsI	GCATC	2 cut(s)	1112, 1132
BpuEI	CTTGAG	3 cut(s)	224, 602, 932
BsaBI	GATNNNNATC	1 cut(s)	117
BsaJI	CCNNGG	3 cut(s)	267, 423, 1068
BsaWI	WCCGGW	1 cut(s)	67
BsaXI	ACNNNNNCTCC	2 cut(s)	1064, 1094
Bsc4I	CCNNNNNNNGG	1 cut(s)	821
Bse1I	ACTGG	1 cut(s)	170
Bse8I	GATNNNNATC	1 cut(s)	117
BseAI	TCCGGA	1 cut(s)	67
BseDI	CCNNGG	3 cut(s)	267, 423, 1068
BseGI	GGATG	4 cut(s)	541, 547, 565, 778
BseJI	GATNNNNATC	1 cut(s)	117
BseLI	CCNNNNNNNGG	1 cut(s)	821
BseNI	ACTGG	1 cut(s)	170
BseRI	GAGGAG	2 cut(s)	341, 812
BseSI	GKGCMC	1 cut(s)	443
BseXI	GCAGC	3 cut(s)	100, 211, 233
BshFI	GGCC	4 cut(s)	148, 422, 826, 980
BsiHKAI	GWGCWC	1 cut(s)	1077
BsiSI	CCGG	1 cut(s)	68
BslFI	GGGAC	3 cut(s)	86, 457, 1005
BslI	CCNNNNNNNGG	1 cut(s)	821
BsmAI	GTCTC	1 cut(s)	584
BsmFI	GGGAC	3 cut(s)	86, 457, 1005
BsnI	GGCC	4 cut(s)	148, 422, 826, 980
Bsp1286I	GDGCHC	2 cut(s)	443, 1077
Bsp13I	TCCGGA	1 cut(s)	67
Bsp1407I	TGTACA	1 cut(s)	214
Bsp143I	GATC	5 cut(s)	10, 112, 184, 757, 922
BspACI	CCGC	2 cut(s)	236, 331
BspANI	GGCC	4 cut(s)	148, 422, 826, 980
BspEI	TCCGGA	1 cut(s)	67
BspHI	TCATGA	1 cut(s)	364
BspLI	GGNNCC	2 cut(s)	12, 1134
BspPI	GGATC	4 cut(s)	5, 18, 107, 179
BspTI	CTTAAG	1 cut(s)	19
BsrBI	CCGCTC	1 cut(s)	331
BsrGI	TGTACA	1 cut(s)	214
BsrI	ACTGG	1 cut(s)	170
BssECI	CCNNGG	3 cut(s)	267, 423, 1068
BssMI	GATC	5 cut(s)	10, 112, 184, 757, 922
BssT1I	CCWWGG	2 cut(s)	423, 1068
Bst6I	CTCTTC	4 cut(s)	61, 789, 995, 1016
BstAFI	CTTAAG	1 cut(s)	19
BstAPI	GCANNNNNTGC	1 cut(s)	1081
BstAUI	TGTACA	1 cut(s)	214
BstC8I	GCNNGC	1 cut(s)	165
BstDEI	CTNAG	1 cut(s)	790
BstDSI	CCRYGG	1 cut(s)	267
BstF5I	GGATG	4 cut(s)	541, 547, 565, 778
BstKTI	GATC	5 cut(s)	13, 115, 187, 760, 925
BstMAI	GTCTC	1 cut(s)	584
BstMBI	GATC	5 cut(s)	10, 112, 184, 757, 922
BstMWI	GCNNNNNNNGC	2 cut(s)	233, 1081
BstNSI	RCATGY	2 cut(s)	597, 845
BstSFI	CTRYAG	2 cut(s)	456, 816
BstSLI	GKGCMC	1 cut(s)	443
BstV1I	GCAGC	3 cut(s)	100, 211, 233
BstX2I	RGATCY	1 cut(s)	10
BstYI	RGATCY	1 cut(s)	10
BsuI	GTATCC	1 cut(s)	541
BsuRI	GGCC	4 cut(s)	148, 422, 826, 980
BtgI	CCRYGG	1 cut(s)	267
BtsCI	GGATG	4 cut(s)	541, 547, 565, 778
Cac8I	GCNNGC	1 cut(s)	165
CciI	TCATGA	1 cut(s)	364
Cfr13I	GGNCC	1 cut(s)	824
Csp6I	GTAC	3 cut(s)	215, 428, 721
CviQI	GTAC	3 cut(s)	215, 428, 721
DdeI	CTNAG	1 cut(s)	790
DpnI	GATC	5 cut(s)	12, 114, 186, 759, 924
DpnII	GATC	5 cut(s)	10, 112, 184, 757, 922
EaeI	YGGCCR	2 cut(s)	146, 978
Eam1104I	CTCTTC	4 cut(s)	61, 789, 995, 1016
EarI	CTCTTC	4 cut(s)	61, 789, 995, 1016
Eco130I	CCWWGG	2 cut(s)	423, 1068
EcoT14I	CCWWGG	2 cut(s)	423, 1068
ErhI	CCWWGG	2 cut(s)	423, 1068
FalI	AAGNNNNNCTT	2 cut(s)	894, 926
FaqI	GGGAC	3 cut(s)	86, 457, 1005
FauI	CCCGC	1 cut(s)	324
FauNDI	CATATG	1 cut(s)	637
FbaI	TGATCA	1 cut(s)	922
Fnu4HI	GCNGC	3 cut(s)	89, 222, 225
FokI	GGATG	4 cut(s)	548, 554, 572, 785
Fsp4HI	GCNGC	3 cut(s)	89, 222, 225
FspBI	CTAG	1 cut(s)	1100
GluI	GCNGC	3 cut(s)	89, 222, 225
HaeIII	GGCC	4 cut(s)	148, 422, 826, 980
HapII	CCGG	1 cut(s)	68
HincII	GTYRAC	1 cut(s)	375
HindII	GTYRAC	1 cut(s)	375
HinfI	GANTC	9 cut(s)	64, 134, 242, 356, 524, 659, 800, 970, 1093
HpaII	CCGG	1 cut(s)	68
HphI	GGTGA	4 cut(s)	683, 949, 956, 1088
Hpy166II	GTNNAC	1 cut(s)	375
Hpy188III	TCNNGA	6 cut(s)	68, 353, 365, 761, 911, 1151
Hpy8I	GTNNAC	1 cut(s)	375
HpyF10VI	GCNNNNNNNGC	2 cut(s)	233, 1081
HpyF3I	CTNAG	1 cut(s)	790
Kpn2I	TCCGGA	1 cut(s)	67
Ksp22I	TGATCA	1 cut(s)	922
Kzo9I	GATC	5 cut(s)	10, 112, 184, 757, 922
LmnI	GCTCC	2 cut(s)	328, 1072
LpnPI	CCDG	7 cut(s)	81, 183, 203, 654, 677, 744, 867
Lsp1109I	GCAGC	3 cut(s)	100, 211, 233
LweI	GCATC	2 cut(s)	1112, 1132
MaeI	CTAG	1 cut(s)	1100
MaeIII	GTNAC	3 cut(s)	481, 609, 1063
MalI	GATC	5 cut(s)	12, 114, 186, 759, 924
MbiI	CCGCTC	1 cut(s)	331
MboI	GATC	5 cut(s)	10, 112, 184, 757, 922
MfeI	CAATTG	1 cut(s)	210
MflI	RGATCY	1 cut(s)	10
MhlI	GDGCHC	2 cut(s)	443, 1077
MluCI	AATT	7 cut(s)	210, 297, 304, 528, 677, 831, 955
MlyI	GAGTC	3 cut(s)	365, 533, 809
MmeI	TCCRAC	3 cut(s)	20, 316, 828
MroI	TCCGGA	1 cut(s)	67
MseI	TTAA	4 cut(s)	20, 303, 687, 1086
MslI	CAYNNNNRTG	2 cut(s)	142, 714
MspA1I	CMGCKG	1 cut(s)	224
MspCI	CTTAAG	1 cut(s)	19
MspI	CCGG	1 cut(s)	68
MunI	CAATTG	1 cut(s)	210
MwoI	GCNNNNNNNGC	2 cut(s)	233, 1081
NdeI	CATATG	1 cut(s)	637
NdeII	GATC	5 cut(s)	10, 112, 184, 757, 922
NlaIV	GGNNCC	2 cut(s)	12, 1134
NmuCI	GTSAC	1 cut(s)	481
NspI	RCATGY	2 cut(s)	597, 845
PagI	TCATGA	1 cut(s)	364
PciI	ACATGT	1 cut(s)	593
PfeI	GAWTC	6 cut(s)	64, 134, 242, 659, 970, 1093
PkrI	GCNGC	3 cut(s)	90, 223, 226
PleI	GAGTC	3 cut(s)	364, 532, 808
PpsI	GAGTC	3 cut(s)	364, 532, 808
PscI	ACATGT	1 cut(s)	593
PshBI	ATTAAT	1 cut(s)	303
PspN4I	GGNNCC	2 cut(s)	12, 1134
PspPI	GGNCC	1 cut(s)	824
PsuI	RGATCY	1 cut(s)	10
PvuII	CAGCTG	1 cut(s)	224
RsaI	GTAC	3 cut(s)	216, 429, 722
RsaNI	GTAC	3 cut(s)	215, 428, 721
RseI	CAYNNNNRTG	2 cut(s)	142, 714
SaqAI	TTAA	4 cut(s)	20, 303, 687, 1086
SatI	GCNGC	3 cut(s)	89, 222, 225
Sau3AI	GATC	5 cut(s)	10, 112, 184, 757, 922
Sau96I	GGNCC	1 cut(s)	824
SchI	GAGTC	3 cut(s)	365, 533, 809
SduI	GDGCHC	2 cut(s)	443, 1077
SfaNI	GCATC	2 cut(s)	1112, 1132
SfcI	CTRYAG	2 cut(s)	456, 816
SmiMI	CAYNNNNRTG	2 cut(s)	142, 714
SmlI	CTYRAG	4 cut(s)	19, 203, 581, 911
SmoI	CTYRAG	4 cut(s)	19, 203, 581, 911
Sse9I	AATT	7 cut(s)	210, 297, 304, 528, 677, 831, 955
SsiI	CCGC	2 cut(s)	236, 331
SspI	AATATT	2 cut(s)	130, 277
SspMI	CTAG	1 cut(s)	1100
StyI	CCWWGG	2 cut(s)	423, 1068
TaqI	TCGA	1 cut(s)	875
TasI	AATT	7 cut(s)	210, 297, 304, 528, 677, 831, 955
TatI	WGTACW	1 cut(s)	214
TfiI	GAWTC	6 cut(s)	64, 134, 242, 659, 970, 1093
Tru1I	TTAA	4 cut(s)	20, 303, 687, 1086
Tru9I	TTAA	4 cut(s)	20, 303, 687, 1086
TseFI	GTSAC	1 cut(s)	481
TseI	GCWGC	3 cut(s)	88, 221, 224
Tsp45I	GTSAC	1 cut(s)	481
TspDTI	ATGAA	8 cut(s)	48, 126, 130, 206, 585, 654, 698, 1106
Vha464I	CTTAAG	1 cut(s)	19
VspI	ATTAAT	1 cut(s)	303
XapI	RAATTY	1 cut(s)	677
XceI	RCATGY	2 cut(s)	597, 845
XcmI	CCANNNNNNNNNTGG	1 cut(s)	430
XspI	CTAG	1 cut(s)	1100

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.