Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013054.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Reverse (-)

2761 .. 3743

Gene Structure 983 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013054.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 927 bp

atgcttggaggatttcaagataaccaaaggcattggaataattactattctcctccatacaatccggcatgggataatcctccttactcttcgtggaatgacgatccaaaaggacaacaagcttcagatgcttcttttcaagcttggattcaggaaaagcaagctcttgatgatgatttggcagaaaaactaaagcgtttggagaacttaatatctcaggagcatccttctaaaccaatggcaactttaggggagctcccgacaactacggttttgtgtcaacctcatgatgcagtccatgattcaacatttgatgaggatgaagtaatggatttggaggagtcttataaagagccactcaacgttgagatttttgaggatcactacatgaccgagcttgaaaagtgggaaatggaagatccctttgatgatgaggaatcctatcatgaagaaagtaaggatgagcttcatgcaaatgtgccccaagtgcctgaaacaaacatgttacctaatgaagatccaaaaggatatgaggccacaatggaggattgcttaaaagaagattccatcaaagctcctacatttggacctttattgctagcacatggaagaccatttgatcctataacgcctcattcaacctctacacatgttctccccatccaagcaacagttgagtttgttgatcatgtggagatggtcataagtgaacatctcaaatcacataaggagatcattctagctgtgattgttgaacttaagaaaagaaggagacaatggaagaagagaaagaaaaagagaagcatcaaatcctatctttccattgctcccaagttacctaagttgctagaaagggcccatgaaacatctttgaagaagcttaagcatctgatcgaaccgcggcctaaacctcttgattactcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

308

Amino Acids

35.78

Weight (kDa)

5.12

Isoelectric Point (pI)

53.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	348
AccII	CGCG	1 cut(s)	901
AciI	CCGC	2 cut(s)	899, 901
AclI	AACGTT	1 cut(s)	363
AclWI	GGATC	5 cut(s)	98, 387, 413, 512, 614
AcuI	CTGAAG	1 cut(s)	108
AfiI	CCNNNNNNNGG	1 cut(s)	584
AflII	CTTAAG	2 cut(s)	758, 881
AflIII	ACRYGT	2 cut(s)	501, 649
AgsI	TTSAA	7 cut(s)	17, 140, 306, 401, 639, 755, 874
AluBI	AGCT	9 cut(s)	122, 143, 164, 256, 397, 466, 575, 743, 880
AluI	AGCT	9 cut(s)	122, 143, 164, 256, 397, 466, 575, 743, 880
Alw21I	GWGCWC	1 cut(s)	258
Alw26I	GTCTC	1 cut(s)	766
AlwI	GGATC	5 cut(s)	98, 387, 413, 512, 614
AoxI	GGCC	3 cut(s)	534, 855, 902
ApaI	GGGCCC	1 cut(s)	859
AspS9I	GGNCC	3 cut(s)	587, 855, 856
AsuNHI	GCTAGC	1 cut(s)	598
AvaII	GGWCC	1 cut(s)	587
BaeGI	GKGCMC	2 cut(s)	483, 859
BanII	GRGCYC	2 cut(s)	258, 859
BbsI	GAAGAC	1 cut(s)	616
Bbv12I	GWGCWC	1 cut(s)	258
BccI	CCATC	3 cut(s)	575, 668, 691
BclI	TGATCA	1 cut(s)	685
BcoDI	GTCTC	1 cut(s)	766
BfaI	CTAG	3 cut(s)	599, 740, 848
BfrI	CTTAAG	2 cut(s)	758, 881
BisI	GCNGC	1 cut(s)	902
BlsI	GCNGC	1 cut(s)	903
Bme18I	GGWCC	1 cut(s)	587
BmgT120I	GGNCC	3 cut(s)	587, 855, 856
BmiI	GGNNCC	1 cut(s)	857
BmsI	GCATC	5 cut(s)	118, 232, 280, 813, 895
BmtI	GCTAGC	1 cut(s)	602
BpiI	GAAGAC	1 cut(s)	616
BsaJI	CCNNGG	1 cut(s)	899
BsaXI	ACNNNNNCTCC	2 cut(s)	639, 669
Bsc4I	CCNNNNNNNGG	1 cut(s)	584
Bse3DI	GCAATG	1 cut(s)	822
BseDI	CCNNGG	1 cut(s)	899
BseGI	GGATG	4 cut(s)	223, 325, 466, 660
BseLI	CCNNNNNNNGG	1 cut(s)	584
BseMI	GCAATG	1 cut(s)	822
BseMII	CTCAG	1 cut(s)	230
BseRI	GAGGAG	2 cut(s)	42, 353
BseSI	GKGCMC	2 cut(s)	483, 859
Bsh1236I	CGCG	1 cut(s)	901
BshFI	GGCC	3 cut(s)	536, 857, 904
BsiHKAI	GWGCWC	1 cut(s)	258
BsiSI	CCGG	1 cut(s)	65
BslI	CCNNNNNNNGG	1 cut(s)	584
BsmAI	GTCTC	1 cut(s)	766
BsnI	GGCC	3 cut(s)	536, 857, 904
Bsp120I	GGGCCC	1 cut(s)	855
Bsp1286I	GDGCHC	3 cut(s)	258, 483, 859
Bsp143I	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
BspACI	CCGC	2 cut(s)	899, 901
BspANI	GGCC	3 cut(s)	536, 857, 904
BspCNI	CTCAG	1 cut(s)	229
BspFNI	CGCG	1 cut(s)	901
BspHI	TCATGA	2 cut(s)	286, 445
BspLI	GGNNCC	1 cut(s)	857
BspOI	GCTAGC	1 cut(s)	602
BspPI	GGATC	5 cut(s)	98, 387, 413, 512, 614
BspTI	CTTAAG	2 cut(s)	758, 881
BsrDI	GCAATG	1 cut(s)	822
BssECI	CCNNGG	1 cut(s)	899
BssMI	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
Bst4CI	ACNGT	2 cut(s)	271, 673
Bst6I	CTCTTC	2 cut(s)	94, 779
BstAFI	CTTAAG	2 cut(s)	758, 881
BstC8I	GCNNGC	2 cut(s)	162, 600
BstDEI	CTNAG	2 cut(s)	216, 840
BstDSI	CCRYGG	1 cut(s)	899
BstF5I	GGATG	4 cut(s)	223, 325, 466, 660
BstFNI	CGCG	1 cut(s)	901
BstKTI	GATC	8 cut(s)	106, 382, 421, 520, 622, 688, 735, 894
BstMAI	GTCTC	1 cut(s)	766
BstMBI	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
BstMWI	GCNNNNNNNGC	2 cut(s)	128, 487
BstNSI	RCATGY	2 cut(s)	505, 653
BstSLI	GKGCMC	2 cut(s)	483, 859
BstUI	CGCG	1 cut(s)	901
BstV2I	GAAGAC	1 cut(s)	616
BstX2I	RGATCY	2 cut(s)	418, 517
BstYI	RGATCY	2 cut(s)	418, 517
BsuRI	GGCC	3 cut(s)	536, 857, 904
BtgI	CCRYGG	1 cut(s)	899
BtsCI	GGATG	4 cut(s)	223, 325, 466, 660
Cac8I	GCNNGC	2 cut(s)	162, 600
CciI	TCATGA	2 cut(s)	286, 445
Cfr13I	GGNCC	3 cut(s)	587, 855, 856
Cfr42I	CCGCGG	1 cut(s)	902
DdeI	CTNAG	2 cut(s)	216, 840
DpnI	GATC	8 cut(s)	105, 381, 420, 519, 621, 687, 734, 893
DpnII	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
Eam1104I	CTCTTC	2 cut(s)	94, 779
EarI	CTCTTC	2 cut(s)	94, 779
Ecl136II	GAGCTC	1 cut(s)	256
Eco24I	GRGCYC	2 cut(s)	258, 859
Eco47I	GGWCC	1 cut(s)	587
Eco53kI	GAGCTC	1 cut(s)	256
Eco57I	CTGAAG	1 cut(s)	108
EcoICRI	GAGCTC	1 cut(s)	256
EcoO109I	RGGNCCY	1 cut(s)	855
EcoT38I	GRGCYC	2 cut(s)	258, 859
FbaI	TGATCA	1 cut(s)	685
Fnu4HI	GCNGC	1 cut(s)	902
FokI	GGATG	4 cut(s)	210, 332, 473, 647
FriOI	GRGCYC	2 cut(s)	258, 859
Fsp4HI	GCNGC	1 cut(s)	902
FspBI	CTAG	3 cut(s)	599, 740, 848
GluI	GCNGC	1 cut(s)	902
HaeIII	GGCC	3 cut(s)	536, 857, 904
HapII	CCGG	1 cut(s)	65
HincII	GTYRAC	1 cut(s)	281
HindII	GTYRAC	1 cut(s)	281
HindIII	AAGCTT	3 cut(s)	120, 141, 878
HinfI	GANTC	5 cut(s)	148, 302, 341, 437, 563
HpaII	CCGG	1 cut(s)	65
Hpy166II	GTNNAC	2 cut(s)	281, 710
Hpy188I	TCNGA	2 cut(s)	127, 891
Hpy188III	TCNNGA	9 cut(s)	17, 152, 167, 218, 259, 287, 446, 914, 924
Hpy8I	GTNNAC	2 cut(s)	281, 710
HpyAV	CCTTC	2 cut(s)	237, 762
HpyCH4III	ACNGT	2 cut(s)	271, 673
HpyCH4IV	ACGT	1 cut(s)	363
HpyCH4V	TGCA	2 cut(s)	293, 473
HpyF10VI	GCNNNNNNNGC	2 cut(s)	128, 487
HpyF3I	CTNAG	2 cut(s)	216, 840
HpySE526I	ACGT	1 cut(s)	363
Ksp22I	TGATCA	1 cut(s)	685
KspI	CCGCGG	1 cut(s)	902
Kzo9I	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
LmnI	GCTCC	5 cut(s)	220, 253, 261, 580, 832
LpnPI	CCDG	4 cut(s)	78, 137, 203, 504
LweI	GCATC	5 cut(s)	118, 232, 280, 813, 895
MaeI	CTAG	3 cut(s)	599, 740, 848
MaeII	ACGT	1 cut(s)	363
MaeIII	GTNAC	2 cut(s)	504, 834
MalI	GATC	8 cut(s)	105, 381, 420, 519, 621, 687, 734, 893
MboI	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
MboII	GAAGA	9 cut(s)	81, 428, 461, 527, 572, 621, 793, 796, 886
MflI	RGATCY	2 cut(s)	418, 517
MhlI	GDGCHC	3 cut(s)	258, 483, 859
MluCI	AATT	1 cut(s)	40
MlyI	GAGTC	1 cut(s)	350
MseI	TTAA	4 cut(s)	209, 554, 759, 882
MslI	CAYNNNNRTG	1 cut(s)	474
MspA1I	CMGCKG	1 cut(s)	901
MspCI	CTTAAG	2 cut(s)	758, 881
MspI	CCGG	1 cut(s)	65
MvnI	CGCG	1 cut(s)	901
MwoI	GCNNNNNNNGC	2 cut(s)	128, 487
NdeII	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
NheI	GCTAGC	1 cut(s)	598
NlaIV	GGNNCC	1 cut(s)	857
NspI	RCATGY	2 cut(s)	505, 653
PagI	TCATGA	2 cut(s)	286, 445
PciI	ACATGT	2 cut(s)	501, 649
PfeI	GAWTC	4 cut(s)	148, 302, 437, 563
PkrI	GCNGC	1 cut(s)	903
PleI	GAGTC	1 cut(s)	349
PpsI	GAGTC	1 cut(s)	349
PscI	ACATGT	2 cut(s)	501, 649
PsiI	TTATAA	1 cut(s)	348
Psp124BI	GAGCTC	1 cut(s)	258
Psp1406I	AACGTT	1 cut(s)	363
PspN4I	GGNNCC	1 cut(s)	857
PspOMI	GGGCCC	1 cut(s)	855
PspPI	GGNCC	3 cut(s)	587, 855, 856
PsuI	RGATCY	2 cut(s)	418, 517
RseI	CAYNNNNRTG	1 cut(s)	474
SacI	GAGCTC	1 cut(s)	258
SacII	CCGCGG	1 cut(s)	902
SaqAI	TTAA	4 cut(s)	209, 554, 759, 882
SatI	GCNGC	1 cut(s)	902
Sau3AI	GATC	8 cut(s)	103, 379, 418, 517, 619, 685, 732, 891
Sau96I	GGNCC	3 cut(s)	587, 855, 856
SchI	GAGTC	1 cut(s)	350
SduI	GDGCHC	3 cut(s)	258, 483, 859
SfaNI	GCATC	5 cut(s)	118, 232, 280, 813, 895
Sfr303I	CCGCGG	1 cut(s)	902
SgrBI	CCGCGG	1 cut(s)	902
SinI	GGWCC	1 cut(s)	587
SmiMI	CAYNNNNRTG	1 cut(s)	474
SmlI	CTYRAG	2 cut(s)	758, 881
SmoI	CTYRAG	2 cut(s)	758, 881
Sse9I	AATT	1 cut(s)	40
SsiI	CCGC	2 cut(s)	899, 901
SspMI	CTAG	3 cut(s)	599, 740, 848
SstI	GAGCTC	1 cut(s)	258
TaaI	ACNGT	2 cut(s)	271, 673
TaiI	ACGT	1 cut(s)	366
TaqI	TCGA	1 cut(s)	894
TaqII	GACCGA	1 cut(s)	407
TasI	AATT	1 cut(s)	40
TauI	GCSGC	1 cut(s)	904
TfiI	GAWTC	4 cut(s)	148, 302, 437, 563
Tru1I	TTAA	4 cut(s)	209, 554, 759, 882
Tru9I	TTAA	4 cut(s)	209, 554, 759, 882
TspDTI	ATGAA	5 cut(s)	336, 458, 462, 528, 876
Vha464I	CTTAAG	2 cut(s)	758, 881
VpaK11BI	GGWCC	1 cut(s)	587
XceI	RCATGY	2 cut(s)	505, 653
XspI	CTAG	3 cut(s)	599, 740, 848

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.