Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001524.1

Orthogroup ID

OG0001191

Physical Location & Seq

Genomic Coordinates Forward (+)

35111 .. 35928

Gene Structure 818 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001524.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 495 bp

atggaacttgggagtactgggaccagttgttctacaaggattagatcaaggaagtcgagatttatcggggcagatatggttgggctaaacggagaatccatgaatctcggttctccaacttccacctctgcagtgaattggacgagggtgtttataaggacacagaatcaacatccattgacttgtaccatcgagcaattttggataacggtgctacttgaaccctcaggccaatttaatgcacctgaaggggacgagcctttggctttggacatggggagcatggggaagggtgaagtacggataaatggggggaacattggaagatactggactgttcatgctaatgggtatcatggtcctcggtcttggctcaagccatcccaaaatctgttggtgttttttgagaagcttgctggcgattttacaaagattgatattctgaaagtcacccacatgttgagaaatggcagaccaagaaccgaggcaaactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004553 GO:0004565 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0009505 GO:0015925 GO:0016787 GO:0016798 GO:0030312 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Gal_Lectin Glyco_hydro_35

Protein Analysis

164

Amino Acids

18.18

Weight (kDa)

9.38

Isoelectric Point (pI)

27.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001191)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G18710
fragaria_vesca	FvH4_1g27957 FvH4_1g28030
rosa_chinensis	RchiOBHm_Chr2g0113301 RchiOBHm_Chr2g0122841 RchiOBHm_Chr4g0401441 RchiOBHm_Chr4g0401561 RchiOBHm_Chr4g0416291 RchiOBHm_Chr5g0037611 RchiOBHm_Chr5g0049841 RchiOBHm_Chr5g0066171 RchiOBHm_Chr5g0083681 RchiOBHm_Chr6g0266211 RchiOBHm_Chr7g0208141 RchiOBHm_Chr7g0224481 RchiOBHm_Chr7g0232071
rosa_laevigata	RLG00000001559 RLG00000008727 RLG00000008954 RLG00000011600 RLG00000012442 RLG00000013273 RLG00000013821 RLG00000017804 RLG00000021255 RLG00000030030 RLG00000034328 RLG00000034997
rosa_multiflora	Rmu_sc0001524.1_g000008 Rmu_sc0004679.1_g000008 Rmu_sc0006792.1_g000040 Rmu_sc0008528.1_g000002 Rmu_sc0016149.1_g000001 Rmu_sc0020923.1_g000001
rosa_roxburghii	Rroxscaffold_1G00003710 Rroxscaffold_1G00003720 Rroxscaffold_2G00101750 Rroxscaffold_2G00137690 Rroxscaffold_3G00261390
rosa_rugosa	Rorug01G0086800 Rorug03G0275400 Rorug03G0275400 Rorug03G0275500 Rorug03G0275600
rosa_samantha	Rh1BG230300 Rh1DG258100 Rh2AG301400 Rh5BG563200 Rh5CG423100 Rh5CG585400 Rh5DG351000 Rh5DG354200 Rh5DG465100 Rh6CG409900 Rh7AG234300 Rh7DG241700
rosa_wichuraiana	Rw5G050500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	155
AcuI	CTGAAG	1 cut(s)	267
AfaI	GTAC	3 cut(s)	16, 187, 300
AflIII	ACRYGT	1 cut(s)	456
AgsI	TTSAA	1 cut(s)	221
AloI	GAACNNNNNNTCC	2 cut(s)	13, 45
AluBI	AGCT	1 cut(s)	412
AluI	AGCT	1 cut(s)	412
AoxI	GGCC	1 cut(s)	229
AspS9I	GGNCC	2 cut(s)	21, 359
AsuHPI	GGTGA	2 cut(s)	305, 442
AvaII	GGWCC	2 cut(s)	21, 359
AxyI	CCTNAGG	1 cut(s)	226
BccI	CCATC	2 cut(s)	197, 388
BfmI	CTRYAG	1 cut(s)	129
BmcAI	AGTACT	1 cut(s)	16
Bme18I	GGWCC	2 cut(s)	21, 359
BmgT120I	GGNCC	2 cut(s)	21, 359
BmiI	GGNNCC	1 cut(s)	22
BmrI	ACTGGG	1 cut(s)	27
BmuI	ACTGGG	1 cut(s)	27
BpuEI	CTTGAG	1 cut(s)	359
BsaJI	CCNNGG	2 cut(s)	362, 483
Bse1I	ACTGG	3 cut(s)	22, 24, 335
Bse21I	CCTNAGG	1 cut(s)	226
BseDI	CCNNGG	2 cut(s)	362, 483
BseGI	GGATG	2 cut(s)	172, 380
BseMII	CTCAG	1 cut(s)	240
BseNI	ACTGG	3 cut(s)	22, 24, 335
BshFI	GGCC	1 cut(s)	231
BslFI	GGGAC	2 cut(s)	34, 266
BsmFI	GGGAC	2 cut(s)	34, 266
BsnI	GGCC	1 cut(s)	231
Bsp143I	GATC	1 cut(s)	44
BspANI	GGCC	1 cut(s)	231
BspCNI	CTCAG	1 cut(s)	239
BspLI	GGNNCC	1 cut(s)	22
BspMAI	CTGCAG	1 cut(s)	133
BsrI	ACTGG	3 cut(s)	22, 24, 335
BssECI	CCNNGG	2 cut(s)	362, 483
BssMI	GATC	1 cut(s)	44
Bst4CI	ACNGT	2 cut(s)	211, 337
BstC8I	GCNNGC	2 cut(s)	414, 418
BstDEI	CTNAG	1 cut(s)	226
BstF5I	GGATG	2 cut(s)	172, 380
BstKTI	GATC	1 cut(s)	47
BstMBI	GATC	1 cut(s)	44
BstNSI	RCATGY	1 cut(s)	460
BstSFI	CTRYAG	1 cut(s)	129
Bsu36I	CCTNAGG	1 cut(s)	226
BsuRI	GGCC	1 cut(s)	231
BtsCI	GGATG	2 cut(s)	172, 380
BtsI	GCAGTG	1 cut(s)	138
BtsIMutI	CAGTG	1 cut(s)	138
Cac8I	GCNNGC	2 cut(s)	414, 418
Cfr13I	GGNCC	2 cut(s)	21, 359
Csp6I	GTAC	3 cut(s)	15, 186, 299
CviAII	CATG	6 cut(s)	100, 274, 283, 341, 356, 457
CviJI	RGCY	7 cut(s)	85, 231, 259, 266, 373, 379, 412
CviKI_1	RGCY	7 cut(s)	85, 231, 259, 266, 373, 379, 412
CviQI	GTAC	3 cut(s)	15, 186, 299
DdeI	CTNAG	1 cut(s)	226
DpnI	GATC	1 cut(s)	46
DpnII	GATC	1 cut(s)	44
Eco47I	GGWCC	2 cut(s)	21, 359
Eco57I	CTGAAG	1 cut(s)	267
Eco81I	CCTNAGG	1 cut(s)	226
FaeI	CATG	6 cut(s)	103, 277, 286, 344, 359, 460
FaiI	YATR	8 cut(s)	77, 101, 155, 275, 284, 342, 357, 458
FaqI	GGGAC	2 cut(s)	34, 266
FatI	CATG	6 cut(s)	99, 273, 282, 340, 355, 456
FokI	GGATG	2 cut(s)	159, 367
HaeIII	GGCC	1 cut(s)	231
Hin1II	CATG	6 cut(s)	103, 277, 286, 344, 359, 460
HindIII	AAGCTT	1 cut(s)	410
HinfI	GANTC	3 cut(s)	95, 103, 166
HphI	GGTGA	2 cut(s)	305, 442
Hpy188I	TCNGA	1 cut(s)	444
Hpy188III	TCNNGA	1 cut(s)	57
HpyAV	CCTTC	2 cut(s)	242, 283
HpyCH4III	ACNGT	2 cut(s)	211, 337
HpyCH4V	TGCA	2 cut(s)	131, 242
HpyF3I	CTNAG	1 cut(s)	226
Hsp92II	CATG	6 cut(s)	103, 277, 286, 344, 359, 460
Kzo9I	GATC	1 cut(s)	44
LmnI	GCTCC	1 cut(s)	279
LpnPI	CCDG	6 cut(s)	3, 37, 213, 258, 316, 402
MaeIII	GTNAC	1 cut(s)	448
MalI	GATC	1 cut(s)	46
MboI	GATC	1 cut(s)	44
MboII	GAAGA	1 cut(s)	336
MluCI	AATT	3 cut(s)	136, 197, 233
MmeI	TCCRAC	1 cut(s)	140
MnlI	CCTC	5 cut(s)	136, 138, 235, 372, 478
MseI	TTAA	1 cut(s)	237
MslI	CAYNNNNRTG	2 cut(s)	345, 455
NdeII	GATC	1 cut(s)	44
NlaIII	CATG	6 cut(s)	103, 277, 286, 344, 359, 460
NlaIV	GGNNCC	1 cut(s)	22
NmuCI	GTSAC	1 cut(s)	448
NspI	RCATGY	1 cut(s)	460
PciI	ACATGT	1 cut(s)	456
PfeI	GAWTC	3 cut(s)	95, 103, 166
PscI	ACATGT	1 cut(s)	456
PsiI	TTATAA	1 cut(s)	155
PspN4I	GGNNCC	1 cut(s)	22
PspPI	GGNCC	2 cut(s)	21, 359
PstI	CTGCAG	1 cut(s)	133
RsaI	GTAC	3 cut(s)	16, 187, 300
RsaNI	GTAC	3 cut(s)	15, 186, 299
RseI	CAYNNNNRTG	2 cut(s)	345, 455
SaqAI	TTAA	1 cut(s)	237
Sau3AI	GATC	1 cut(s)	44
Sau96I	GGNCC	2 cut(s)	21, 359
ScaI	AGTACT	1 cut(s)	16
SetI	ASST	3 cut(s)	128, 247, 414
SfcI	CTRYAG	1 cut(s)	129
SinI	GGWCC	2 cut(s)	21, 359
SmiMI	CAYNNNNRTG	2 cut(s)	345, 455
SmlI	CTYRAG	1 cut(s)	374
SmoI	CTYRAG	1 cut(s)	374
Sse9I	AATT	3 cut(s)	136, 197, 233
TaaI	ACNGT	2 cut(s)	211, 337
TaqI	TCGA	2 cut(s)	56, 192
TaqII	GACCGA	1 cut(s)	354
TasI	AATT	3 cut(s)	136, 197, 233
TatI	WGTACW	1 cut(s)	14
TfiI	GAWTC	3 cut(s)	95, 103, 166
Tru1I	TTAA	1 cut(s)	237
Tru9I	TTAA	1 cut(s)	237
TscAI	CASTG	1 cut(s)	138
TseFI	GTSAC	1 cut(s)	448
Tsp45I	GTSAC	1 cut(s)	448
TspDTI	ATGAA	2 cut(s)	116, 329
TspGWI	ACGGA	2 cut(s)	105, 316
TspRI	CASTG	1 cut(s)	138
VpaK11BI	GGWCC	2 cut(s)	21, 359
XceI	RCATGY	1 cut(s)	460
ZrmI	AGTACT	1 cut(s)	16

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.