Rroxscaffold_3G00261390

squalene

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
55670838 .. 55678659
7822 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00261390.1

Sequence Viewer

Length: 312 bp
ATGCCTTTAATATATGTTAAACTTTATACCTACCAGGTAAATCCACACACACATCAGCTGAAACTTTGTGAATTTGGGAGTGCAAAAGTCTTGAGTGAGCCAGACAGAATTGTTGGGGAGCTATTGCAGCCTGGGGGATATCTCAAATTGATTGAGTTGGGTCTTGGAGATTGTGCAAATGAGTCTATTGATGCCCAGAAAGTGTTTGGTTATGCTTTTTACAAAGATGGGAAGGATACAACACTGTCTTATCCCTTGGAGGCTTGGAGGCATCTGCTCATATGGACCAGTTTCTCTTCTCTCTGGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.73

Weight (kDa)

5.84

Isoelectric Point (pI)

25.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 71
AjnI CCWGG 2 cut(s) 33, 130
AluBI AGCT 2 cut(s) 58, 121
AluI AGCT 2 cut(s) 58, 121
ApeKI GCWGC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 285
AvaII GGWCC 1 cut(s) 285
BbvI GCAGC 1 cut(s) 139
BccI CCATC 1 cut(s) 221
BciT130I CCWGG 2 cut(s) 35, 132
BciVI GTATCC 1 cut(s) 229
BfuI GTATCC 1 cut(s) 229
BisI GCNGC 1 cut(s) 128
BlsI GCNGC 1 cut(s) 129
Bme1390I CCNGG 2 cut(s) 35, 132
Bme18I GGWCC 1 cut(s) 285
BmgT120I GGNCC 1 cut(s) 285
BmrFI CCNGG 2 cut(s) 35, 132
BmsI GCATC 2 cut(s) 181, 280
BpuEI CTTGAG 1 cut(s) 112
BsaJI CCNNGG 2 cut(s) 131, 255
Bse1I ACTGG 1 cut(s) 288
BseBI CCWGG 2 cut(s) 35, 132
BseDI CCNNGG 2 cut(s) 131, 255
BseNI ACTGG 1 cut(s) 288
BseXI GCAGC 1 cut(s) 139
BsrI ACTGG 1 cut(s) 288
BssECI CCNNGG 2 cut(s) 131, 255
BssT1I CCWWGG 1 cut(s) 255
Bst2UI CCWGG 2 cut(s) 35, 132
Bst4CI ACNGT 1 cut(s) 246
Bst6I CTCTTC 1 cut(s) 301
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNI CCWGG 2 cut(s) 35, 132
BstSCI CCNGG 2 cut(s) 33, 130
BstV1I GCAGC 1 cut(s) 139
BsuI GTATCC 1 cut(s) 229
BtsIMutI CAGTG 1 cut(s) 242
Cfr13I GGNCC 1 cut(s) 285
CsiI ACCWGGT 1 cut(s) 33
CviJI RGCY 5 cut(s) 58, 100, 121, 130, 263
CviKI_1 RGCY 5 cut(s) 58, 100, 121, 130, 263
Eam1104I CTCTTC 1 cut(s) 301
EarI CTCTTC 1 cut(s) 301
Eco130I CCWWGG 1 cut(s) 255
Eco32I GATATC 1 cut(s) 140
Eco47I GGWCC 1 cut(s) 285
EcoRII CCWGG 2 cut(s) 33, 130
EcoRV GATATC 1 cut(s) 140
EcoT14I CCWWGG 1 cut(s) 255
ErhI CCWWGG 1 cut(s) 255
FaiI YATR 6 cut(s) 13, 15, 27, 213, 281, 283
FauNDI CATATG 1 cut(s) 281
Fnu4HI GCNGC 1 cut(s) 128
Fsp4HI GCNGC 1 cut(s) 128
GluI GCNGC 1 cut(s) 128
HinfI GANTC 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 91
HpyAV CCTTC 1 cut(s) 226
HpyCH4III ACNGT 1 cut(s) 246
HpyCH4V TGCA 3 cut(s) 83, 127, 176
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
LmnI GCTCC 1 cut(s) 118
LpnPI CCDG 8 cut(s) 20, 47, 114, 117, 144, 209, 289, 301
Lsp1109I GCAGC 1 cut(s) 139
LweI GCATC 2 cut(s) 181, 280
MabI ACCWGGT 1 cut(s) 33
MboII GAAGA 1 cut(s) 288
MluCI AATT 3 cut(s) 71, 108, 146
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 2 cut(s) 253, 261
MseI TTAA 3 cut(s) 8, 18, 310
MspA1I CMGCKG 1 cut(s) 58
MspR9I CCNGG 2 cut(s) 35, 132
MvaI CCWGG 2 cut(s) 35, 132
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeI CATATG 1 cut(s) 281
PkrI GCNGC 1 cut(s) 129
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
Psp6I CCWGG 2 cut(s) 33, 130
PspGI CCWGG 2 cut(s) 33, 130
PspPI GGNCC 1 cut(s) 285
PvuII CAGCTG 1 cut(s) 58
SaqAI TTAA 3 cut(s) 8, 18, 310
SatI GCNGC 1 cut(s) 128
Sau96I GGNCC 1 cut(s) 285
SchI GAGTC 1 cut(s) 191
ScrFI CCNGG 2 cut(s) 35, 132
SetI ASST 4 cut(s) 32, 39, 60, 123
SexAI ACCWGGT 1 cut(s) 33
SfaNI GCATC 2 cut(s) 181, 280
SinI GGWCC 1 cut(s) 285
SmlI CTYRAG 1 cut(s) 91
SmoI CTYRAG 1 cut(s) 91
Sse9I AATT 3 cut(s) 71, 108, 146
StyD4I CCNGG 2 cut(s) 33, 130
StyI CCWWGG 1 cut(s) 255
TaaI ACNGT 1 cut(s) 246
TasI AATT 3 cut(s) 71, 108, 146
Tru1I TTAA 3 cut(s) 8, 18, 310
Tru9I TTAA 3 cut(s) 8, 18, 310
TscAI CASTG 1 cut(s) 249
TseI GCWGC 1 cut(s) 127
TspRI CASTG 1 cut(s) 249
VpaK11BI GGWCC 1 cut(s) 285
XapI RAATTY 1 cut(s) 71
XcmI CCANNNNNNNNNTGG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.