Rmu_sc0020923.1_g000001

Squalene monooxygenase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020923.1
Physical Location & Seq
Reverse (-)
2 .. 438
437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020923.1_g000001.1.cds

Sequence Viewer

Length: 295 bp
atgaattggagtgcaaaagtcttgagtgagccagacagaattgttggggagctattgcagcctgggggatatctcaaattgattgagttgggtcttgaagattgtgcaaatgagtcgattgatgcccagaaagtgtttggttatgctcttacaaagatgggaaggatacaacactgtcttatccctttgaggcttggaggcatctgctcatatgaaccagtttctcttctctctggtcttaaccctcgtccattacacttgtttctccatttctttgcagctgccatctatggtg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.8

Weight (kDa)

6.25

Isoelectric Point (pI)

30.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 98
AjnI CCWGG 1 cut(s) 61
AluBI AGCT 2 cut(s) 52, 281
AluI AGCT 2 cut(s) 52, 281
ApeKI GCWGC 3 cut(s) 58, 278, 281
BbvI GCAGC 3 cut(s) 70, 268, 290
BccI CCATC 2 cut(s) 151, 293
BcgI CGANNNNNNTGC 2 cut(s) 96, 130
BciT130I CCWGG 1 cut(s) 63
BciVI GTATCC 1 cut(s) 159
BfuI GTATCC 1 cut(s) 159
BisI GCNGC 3 cut(s) 59, 279, 282
BlsI GCNGC 3 cut(s) 60, 280, 283
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BmsI GCATC 2 cut(s) 112, 210
BpuEI CTTGAG 1 cut(s) 43
BsaJI CCNNGG 1 cut(s) 62
Bse1I ACTGG 1 cut(s) 218
BseBI CCWGG 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 62
BseNI ACTGG 1 cut(s) 218
BseXI GCAGC 3 cut(s) 70, 268, 290
BsrI ACTGG 1 cut(s) 218
BssECI CCNNGG 1 cut(s) 62
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 176
Bst6I CTCTTC 1 cut(s) 231
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BstV1I GCAGC 3 cut(s) 70, 268, 290
BsuI GTATCC 1 cut(s) 159
BtsIMutI CAGTG 1 cut(s) 172
CviJI RGCY 5 cut(s) 31, 52, 61, 193, 281
CviKI_1 RGCY 5 cut(s) 31, 52, 61, 193, 281
Eam1104I CTCTTC 1 cut(s) 231
EarI CTCTTC 1 cut(s) 231
Eco32I GATATC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 61
EcoRV GATATC 1 cut(s) 71
FaiI YATR 4 cut(s) 144, 211, 213, 291
FauNDI CATATG 1 cut(s) 211
Fnu4HI GCNGC 3 cut(s) 59, 279, 282
Fsp4HI GCNGC 3 cut(s) 59, 279, 282
GluI GCNGC 3 cut(s) 59, 279, 282
HinfI GANTC 1 cut(s) 113
Hpy188III TCNNGA 2 cut(s) 22, 95
HpyAV CCTTC 1 cut(s) 156
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 4 cut(s) 14, 58, 107, 278
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 6 cut(s) 45, 48, 75, 140, 219, 231
Lsp1109I GCAGC 3 cut(s) 70, 268, 290
LweI GCATC 2 cut(s) 112, 210
MboII GAAGA 2 cut(s) 110, 218
MluCI AATT 3 cut(s) 4, 39, 77
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 3 cut(s) 183, 191, 255
MseI TTAA 1 cut(s) 240
MspA1I CMGCKG 1 cut(s) 281
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 58
NdeI CATATG 1 cut(s) 211
PkrI GCNGC 3 cut(s) 60, 280, 283
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PvuII CAGCTG 1 cut(s) 281
SaqAI TTAA 1 cut(s) 240
SatI GCNGC 3 cut(s) 59, 279, 282
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 63
SetI ASST 2 cut(s) 54, 283
SfaNI GCATC 2 cut(s) 112, 210
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 3 cut(s) 4, 39, 77
StyD4I CCNGG 1 cut(s) 61
TaaI ACNGT 1 cut(s) 176
TaqI TCGA 1 cut(s) 116
TasI AATT 3 cut(s) 4, 39, 77
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TscAI CASTG 1 cut(s) 179
TseI GCWGC 3 cut(s) 58, 278, 281
TspDTI ATGAA 2 cut(s) 17, 228
TspRI CASTG 1 cut(s) 179
XcmI CCANNNNNNNNNTGG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.