Rh2AG301400
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
37677778 .. 37679734
1957 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG301400.1

Sequence Viewer

Length: 411 bp
ATGCAAATTTTGGATCATCTAAACATTGTTTCCCTAAAACATTGCTTCTTTTCAACTACAGACAAAGAAGAGGTTTACTTGAATCTCGAACTTAAATTTGTTCCTGAAACTGTTTACCATATCTCAAGGAACTATAGCAGGATCAACCAGCGGATGCCTTTAGTATATGTTAAACTTTATACCTACCAGGTAAATCCACAAACACATCCGCTGAAACTTTGTGATTTTGAGAGTGCAAAAGTCTTGAGTGAGCCAGACAGAATTGTAGGGGAGCTATTGCAACCTGGGGGATATCTCAAATTGATTGAGTTGGGTCTTAAAGCTGCCATTTATGGTGTTGGCCGCTTAATGCTTCCGTTCCCTTCACCTAAACGCATGTGGCTTTGGTTTCTATTGATCTTGAGTGCATGA

Protein Analysis

136

Amino Acids

15.86

Weight (kDa)

8.87

Isoelectric Point (pI)

44.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 151, 209, 343
AclWI GGATC 2 cut(s) 21, 149
AcoI YGGCCR 1 cut(s) 340
AcsI RAATTY 2 cut(s) 6, 95
AgsI TTSAA 2 cut(s) 54, 82
AjnI CCWGG 2 cut(s) 186, 283
AluBI AGCT 2 cut(s) 274, 323
AluI AGCT 2 cut(s) 274, 323
AlwI GGATC 2 cut(s) 21, 149
AoxI GGCC 1 cut(s) 340
ApeKI GCWGC 1 cut(s) 323
ApoI RAATTY 2 cut(s) 6, 95
AsuHPI GGTGA 1 cut(s) 357
BbvI GCAGC 1 cut(s) 310
BciT130I CCWGG 2 cut(s) 188, 285
BfmI CTRYAG 2 cut(s) 57, 133
BisI GCNGC 2 cut(s) 324, 343
BlsI GCNGC 2 cut(s) 325, 344
Bme1390I CCNGG 2 cut(s) 188, 285
BmrFI CCNGG 2 cut(s) 188, 285
BmsI GCATC 1 cut(s) 144
BpuEI CTTGAG 2 cut(s) 109, 265
BsaJI CCNNGG 1 cut(s) 284
Bse3DI GCAATG 1 cut(s) 40
BseBI CCWGG 2 cut(s) 188, 285
BseDI CCNNGG 1 cut(s) 284
BseGI GGATG 2 cut(s) 159, 205
BseMI GCAATG 1 cut(s) 40
BseXI GCAGC 1 cut(s) 310
BshFI GGCC 1 cut(s) 342
BsnI GGCC 1 cut(s) 342
Bsp143I GATC 3 cut(s) 13, 141, 396
BspACI CCGC 3 cut(s) 151, 209, 343
BspANI GGCC 1 cut(s) 342
BspPI GGATC 2 cut(s) 21, 149
BsrDI GCAATG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 284
BssMI GATC 3 cut(s) 13, 141, 396
Bst2UI CCWGG 2 cut(s) 188, 285
Bst4CI ACNGT 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 63
BstF5I GGATG 2 cut(s) 159, 205
BstKTI GATC 3 cut(s) 16, 144, 399
BstMBI GATC 3 cut(s) 13, 141, 396
BstNI CCWGG 2 cut(s) 188, 285
BstNSI RCATGY 1 cut(s) 379
BstSCI CCNGG 2 cut(s) 186, 283
BstSFI CTRYAG 2 cut(s) 57, 133
BstV1I GCAGC 1 cut(s) 310
BsuRI GGCC 1 cut(s) 342
BtsCI GGATG 2 cut(s) 159, 205
CsiI ACCWGGT 1 cut(s) 186
CviAII CATG 2 cut(s) 376, 408
CviJI RGCY 5 cut(s) 253, 274, 323, 342, 382
CviKI_1 RGCY 5 cut(s) 253, 274, 323, 342, 382
DpnI GATC 3 cut(s) 15, 143, 398
DpnII GATC 3 cut(s) 13, 141, 396
EaeI YGGCCR 1 cut(s) 340
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco32I GATATC 1 cut(s) 293
EcoRII CCWGG 2 cut(s) 186, 283
EcoRV GATATC 1 cut(s) 293
FaeI CATG 2 cut(s) 379, 411
FaiI YATR 8 cut(s) 120, 135, 166, 168, 180, 333, 377, 409
FatI CATG 2 cut(s) 375, 407
Fnu4HI GCNGC 2 cut(s) 324, 343
FokI GGATG 2 cut(s) 166, 192
Fsp4HI GCNGC 2 cut(s) 324, 343
GluI GCNGC 2 cut(s) 324, 343
HaeIII GGCC 1 cut(s) 342
Hin1II CATG 2 cut(s) 379, 411
HinfI GANTC 1 cut(s) 82
HphI GGTGA 1 cut(s) 357
Hpy166II GTNNAC 2 cut(s) 76, 115
Hpy188III TCNNGA 4 cut(s) 86, 104, 244, 400
Hpy8I GTNNAC 2 cut(s) 76, 115
HpyAV CCTTC 1 cut(s) 372
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 4 cut(s) 4, 236, 280, 407
Hsp92II CATG 2 cut(s) 379, 411
Kzo9I GATC 3 cut(s) 13, 141, 396
LmnI GCTCC 1 cut(s) 271
LpnPI CCDG 8 cut(s) 117, 124, 161, 173, 200, 267, 270, 297
Lsp1109I GCAGC 1 cut(s) 310
LweI GCATC 1 cut(s) 144
MabI ACCWGGT 1 cut(s) 186
MalI GATC 3 cut(s) 15, 143, 398
MboI GATC 3 cut(s) 13, 141, 396
MboII GAAGA 1 cut(s) 80
MluCI AATT 4 cut(s) 6, 95, 261, 299
MnlI CCTC 1 cut(s) 64
MseI TTAA 4 cut(s) 93, 171, 318, 347
MspA1I CMGCKG 2 cut(s) 151, 211
MspR9I CCNGG 2 cut(s) 188, 285
MvaI CCWGG 2 cut(s) 188, 285
NdeII GATC 3 cut(s) 13, 141, 396
NlaIII CATG 2 cut(s) 379, 411
NspI RCATGY 1 cut(s) 379
PfeI GAWTC 1 cut(s) 82
PkrI GCNGC 2 cut(s) 325, 344
Psp6I CCWGG 2 cut(s) 186, 283
PspGI CCWGG 2 cut(s) 186, 283
SaqAI TTAA 4 cut(s) 93, 171, 318, 347
SatI GCNGC 2 cut(s) 324, 343
Sau3AI GATC 3 cut(s) 13, 141, 396
ScrFI CCNGG 2 cut(s) 188, 285
SetI ASST 7 cut(s) 75, 185, 192, 276, 286, 325, 370
SexAI ACCWGGT 1 cut(s) 186
SfaNI GCATC 1 cut(s) 144
SfcI CTRYAG 2 cut(s) 57, 133
SmlI CTYRAG 3 cut(s) 124, 244, 400
SmoI CTYRAG 3 cut(s) 124, 244, 400
Sse9I AATT 4 cut(s) 6, 95, 261, 299
SsiI CCGC 3 cut(s) 151, 209, 343
StyD4I CCNGG 2 cut(s) 186, 283
TaaI ACNGT 1 cut(s) 112
TaqI TCGA 1 cut(s) 87
TasI AATT 4 cut(s) 6, 95, 261, 299
TauI GCSGC 1 cut(s) 345
TfiI GAWTC 1 cut(s) 82
Tru1I TTAA 4 cut(s) 93, 171, 318, 347
Tru9I TTAA 4 cut(s) 93, 171, 318, 347
TseI GCWGC 1 cut(s) 323
TspGWI ACGGA 1 cut(s) 345
XapI RAATTY 2 cut(s) 6, 95
XceI RCATGY 1 cut(s) 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.