Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004931.1

Orthogroup ID

OG0000977

Physical Location & Seq

Genomic Coordinates Forward (+)

4563 .. 4823

Gene Structure 261 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004931.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

atgggaactattccttggattgcgaatttagagatatacccattgagatacagaggcactggtggagggatatctgcagtttccaactggattgcaaatctcattgtgagtgagacatacttaacccttactaaggaactgggttcggctggaacattcctcctatttgctgggttttctaccattagacttgtattcatttacttactggttcctgaaatcaaaggaatgcaattcgaagaggtcgagaaattgctctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005351 GO:0005355 GO:0005402 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0008150 GO:0008324 GO:0008643 GO:0008645 GO:0015075 GO:0015077 GO:0015078 GO:0015144 GO:0015145 GO:0015149 GO:0015291 GO:0015293 GO:0015294 GO:0015295 GO:0015318 GO:0015672 GO:0015749 GO:0016020 GO:0022804 GO:0022857 GO:0022890 GO:0034219 GO:0034220 GO:0044464 GO:0046323 GO:0051119 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071944 GO:0098655 GO:0098660 GO:0098662 GO:1902600 GO:1904659

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Sugar_tr

Protein Analysis

86

Amino Acids

9.56

Weight (kDa)

5.23

Isoelectric Point (pI)

16.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000977)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g01110 FvH4_2g01110 FvH4_2g01110
malus_domestica	MD10G1335200.v1.1
prunus_persica	Prupe.8G166200_v2.0.a1
pyrus_communis	pycom05g11650 pycom10g28500
rosa_chinensis	RchiOBHm_Chr6g0251681
rosa_laevigata	RLG00000004518 RLG00000012460 RLG00000015438 RLG00000027972 RLG00000031982 RLG00000032117
rosa_multiflora	Rmu_co8207036.1_g000001 Rmu_co8236391.1_g000001 Rmu_sc0000698.1_g000101 Rmu_sc0001382.1_g000034 Rmu_sc0004931.1_g000001 Rmu_sc0029635.1_g000001 Rmu_ssc0000213.1_g000084 Rmu_ssc0000213.1_g000085
rosa_roxburghii	Rroxscaffold_1G00046000 Rroxscaffold_1G00062040 Rroxscaffold_3G00260950 Rroxscaffold_5G00366590 Rroxscaffold_7G00177330 Rroxscaffold_7G00216480
rosa_rugosa	Rorug04G0198700 Rorug05G0134400 Rorug05G0503400
rosa_samantha	Rh1BG329100 Rh1CG342500 Rh1CG342700 Rh1CG344000 Rh1CG344100 Rh1DG359000 Rh1DG359200 Rh1DG359400 Rh1DG359900 Rh1DG360100 Rh1DG360500 Rh1DG360800 Rh1DG361300 Rh1DG361400 Rh1DG361500 Rh3BG297300 Rh4AG255700 Rh4BG261100 Rh5BG110600 Rh5CG296200 Rh6AG013300 Rh6AG013400 Rh6AG013500 Rh6BG012300 Rh6BG012400 Rh6CG009700 Rh6CG169400 Rh6DG010700 Rh6DG161200 Rh7AG267800 Rh7DG115200 Rh7DG330600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	25
AfiI	CCNNNNNNNGG	1 cut(s)	133
AjuI	GAANNNNNNNTTGG	1 cut(s)	30
Alw26I	GTCTC	1 cut(s)	107
ApoI	RAATTY	1 cut(s)	25
AsuII	TTCGAA	1 cut(s)	237
BcoDI	GTCTC	1 cut(s)	107
BfaI	CTAG	1 cut(s)	259
BfmI	CTRYAG	1 cut(s)	75
BmiI	GGNNCC	1 cut(s)	213
BmrI	ACTGGG	1 cut(s)	149
BmuI	ACTGGG	1 cut(s)	149
Bpu14I	TTCGAA	1 cut(s)	237
BsaJI	CCNNGG	1 cut(s)	14
Bsc4I	CCNNNNNNNGG	1 cut(s)	133
Bse1I	ACTGG	4 cut(s)	64, 92, 144, 213
BseDI	CCNNGG	1 cut(s)	14
BseLI	CCNNNNNNNGG	1 cut(s)	133
BseNI	ACTGG	4 cut(s)	64, 92, 144, 213
BseYI	CCCAGC	1 cut(s)	170
BslI	CCNNNNNNNGG	1 cut(s)	133
BsmAI	GTCTC	1 cut(s)	107
BsmI	GAATGC	1 cut(s)	234
Bsp119I	TTCGAA	1 cut(s)	237
BspLI	GGNNCC	1 cut(s)	213
BspMAI	CTGCAG	1 cut(s)	79
BspT104I	TTCGAA	1 cut(s)	237
BsrI	ACTGG	4 cut(s)	64, 92, 144, 213
BssECI	CCNNGG	1 cut(s)	14
BssT1I	CCWWGG	1 cut(s)	14
Bst6I	CTCTTC	1 cut(s)	234
BstBI	TTCGAA	1 cut(s)	237
BstDEI	CTNAG	1 cut(s)	132
BstENI	CCTNNNNNAGG	1 cut(s)	131
BstMAI	GTCTC	1 cut(s)	107
BstSFI	CTRYAG	1 cut(s)	75
BtsIMutI	CAGTG	1 cut(s)	57
CviJI	RGCY	1 cut(s)	149
CviKI_1	RGCY	1 cut(s)	149
DdeI	CTNAG	1 cut(s)	132
Eam1104I	CTCTTC	1 cut(s)	234
EarI	CTCTTC	1 cut(s)	234
Eco130I	CCWWGG	1 cut(s)	14
Eco32I	GATATC	1 cut(s)	72
EcoNI	CCTNNNNNAGG	1 cut(s)	131
EcoRV	GATATC	1 cut(s)	72
EcoT14I	CCWWGG	1 cut(s)	14
ErhI	CCWWGG	1 cut(s)	14
FaiI	YATR	2 cut(s)	37, 118
FspBI	CTAG	1 cut(s)	259
GsaI	CCCAGC	1 cut(s)	174
Hpy188III	TCNNGA	2 cut(s)	215, 247
HpyCH4V	TGCA	3 cut(s)	77, 95, 232
HpyF3I	CTNAG	1 cut(s)	132
LpnPI	CCDG	7 cut(s)	45, 73, 125, 135, 156, 194, 228
MaeI	CTAG	1 cut(s)	259
MboII	GAAGA	1 cut(s)	251
MluCI	AATT	3 cut(s)	25, 233, 251
MmeI	TCCRAC	1 cut(s)	108
MnlI	CCTC	4 cut(s)	47, 59, 170, 235
MseI	TTAA	1 cut(s)	122
Mva1269I	GAATGC	1 cut(s)	234
NlaIV	GGNNCC	1 cut(s)	213
NspV	TTCGAA	1 cut(s)	237
PcsI	WCGNNNNNNNCGW	1 cut(s)	243
PctI	GAATGC	1 cut(s)	234
PspFI	CCCAGC	1 cut(s)	170
PspN4I	GGNNCC	1 cut(s)	213
PstI	CTGCAG	1 cut(s)	79
SaqAI	TTAA	1 cut(s)	122
SetI	ASST	1 cut(s)	246
SfcI	CTRYAG	1 cut(s)	75
SfuI	TTCGAA	1 cut(s)	237
SgeI	CNNG	9 cut(s)	27, 72, 100, 152, 162, 183, 203, 221, 227
Sse9I	AATT	3 cut(s)	25, 233, 251
SspMI	CTAG	1 cut(s)	259
StyI	CCWWGG	1 cut(s)	14
TaqI	TCGA	2 cut(s)	237, 246
TasI	AATT	3 cut(s)	25, 233, 251
Tru1I	TTAA	1 cut(s)	122
Tru9I	TTAA	1 cut(s)	122
TscAI	CASTG	1 cut(s)	64
TspDTI	ATGAA	1 cut(s)	187
TspRI	CASTG	1 cut(s)	64
XagI	CCTNNNNNAGG	1 cut(s)	131
XapI	RAATTY	1 cut(s)	25
XspI	CTAG	1 cut(s)	259

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.