Rh6AG013500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0000977
Physical Location & Seq
Forward (+)
1429356 .. 1429940
585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG013500.1

Sequence Viewer

Length: 585 bp
ATGGACGATCAGAAGCTTGATGCAATGCTTGTTGAAGCGAAGATGAAGTCTCAAGCTTTAGTTGAGGAGTTAGATTCTCACTCCAAGTTTGAGGAACAAATGCTGGAAGCGCTTAAAGCTTACAAAAAAGATTGCAGAAAATGGGAGCAAGACAATAAAGACATTGGTGCAAAATTTGAGGCTGTAATTTCAGCTATTAGAAAAGATCAGCAGACTTTGCTAACTGGTCAAGGACATGTTTGCAAGTGCAAGGCAGAACGCAAGAAATGGGAAAATGAGAAAATCACACTCAATGAACAGCTTGAGGCAGTGAATTCTTGGTACGAGTACCATTTTGAAGTGGCAACGACAGAAAATTATTGGAATCAATACTATATGCAAAGGGAAAATTATTACAGTATTTGGTTGCGTTACTATGAGGACAACATCTACAGCCTTGTCAAGAGTAACAGTGACCCTGCTAAAAGGCTCGAGGTAGAAACTTGTTTGTCCACTAGTTATCACAATCATGTTTTTGACTATGAAGAGAGATGCAGGGCGCTCGAGGAAGACAAGAACAATCGAGCTCACTGCAAAGCTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

194

Amino Acids

23.24

Weight (kDa)

5.48

Isoelectric Point (pI)

38.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 173, 313
AfaI GTAC 2 cut(s) 323, 329
AfeI AGCGCT 1 cut(s) 111
AflIII ACRYGT 1 cut(s) 235
AgsI TTSAA 2 cut(s) 35, 338
AhlI ACTAGT 1 cut(s) 494
AluBI AGCT 7 cut(s) 16, 56, 119, 194, 301, 566, 578
AluI AGCT 7 cut(s) 16, 56, 119, 194, 301, 566, 578
Alw21I GWGCWC 1 cut(s) 568
Alw26I GTCTC 1 cut(s) 54
Ama87I CYCGRG 2 cut(s) 470, 542
Aor51HI AGCGCT 1 cut(s) 111
ApoI RAATTY 2 cut(s) 173, 313
ArsI GACNNNNNNTTYG 2 cut(s) 32, 64
AspLEI GCGC 2 cut(s) 112, 541
AvaI CYCGRG 2 cut(s) 470, 542
BanII GRGCYC 1 cut(s) 568
BbsI GAAGAC 1 cut(s) 555
Bbv12I GWGCWC 1 cut(s) 568
BcgI CGANNNNNNTGC 3 cut(s) 523, 552, 557
BcoDI GTCTC 1 cut(s) 54
BcuI ACTAGT 1 cut(s) 494
BfaI CTAG 1 cut(s) 495
BfmI CTRYAG 1 cut(s) 430
BfoI RGCGCY 2 cut(s) 113, 542
BmeT110I CYCGRG 2 cut(s) 470, 542
BmsI GCATC 2 cut(s) 10, 521
BpiI GAAGAC 1 cut(s) 555
BpuEI CTTGAG 2 cut(s) 36, 323
Bse1I ACTGG 1 cut(s) 229
Bse3DI GCAATG 1 cut(s) 30
BseMI GCAATG 1 cut(s) 30
BseNI ACTGG 1 cut(s) 229
BseRI GAGGAG 1 cut(s) 80
BsiHKAI GWGCWC 1 cut(s) 568
BsiHKCI CYCGRG 2 cut(s) 470, 542
BsmAI GTCTC 1 cut(s) 54
BsoBI CYCGRG 2 cut(s) 470, 542
Bsp1286I GDGCHC 1 cut(s) 568
Bsp143I GATC 2 cut(s) 7, 205
BsrDI GCAATG 1 cut(s) 30
BsrI ACTGG 1 cut(s) 229
BssMI GATC 2 cut(s) 7, 205
Bst4CI ACNGT 2 cut(s) 398, 452
Bst6I CTCTTC 1 cut(s) 519
BstAPI GCANNNNNTGC 1 cut(s) 217
BstH2I RGCGCY 2 cut(s) 113, 542
BstHHI GCGC 2 cut(s) 112, 541
BstKTI GATC 2 cut(s) 10, 208
BstMAI GTCTC 1 cut(s) 54
BstMBI GATC 2 cut(s) 7, 205
BstMWI GCNNNNNNNGC 3 cut(s) 109, 116, 217
BstNSI RCATGY 1 cut(s) 239
BstSFI CTRYAG 1 cut(s) 430
BstV2I GAAGAC 1 cut(s) 555
BtsI GCAGTG 2 cut(s) 315, 568
BtsIMutI CAGTG 3 cut(s) 315, 457, 568
CfoI GCGC 2 cut(s) 112, 541
Csp6I GTAC 2 cut(s) 322, 328
CviAII CATG 2 cut(s) 236, 509
CviQI GTAC 2 cut(s) 322, 328
DpnI GATC 2 cut(s) 9, 207
DpnII GATC 2 cut(s) 7, 205
Eam1104I CTCTTC 1 cut(s) 519
EarI CTCTTC 1 cut(s) 519
Ecl136II GAGCTC 1 cut(s) 566
Eco24I GRGCYC 1 cut(s) 568
Eco47III AGCGCT 1 cut(s) 111
Eco53kI GAGCTC 1 cut(s) 566
Eco88I CYCGRG 2 cut(s) 470, 542
EcoICRI GAGCTC 1 cut(s) 566
EcoRI GAATTC 1 cut(s) 313
EcoT38I GRGCYC 1 cut(s) 568
FaeI CATG 2 cut(s) 239, 512
FaiI YATR 6 cut(s) 237, 375, 377, 417, 510, 522
FatI CATG 2 cut(s) 235, 508
FriOI GRGCYC 1 cut(s) 568
FspBI CTAG 1 cut(s) 495
GlaI GCGC 2 cut(s) 111, 540
HaeII RGCGCY 2 cut(s) 113, 542
HhaI GCGC 2 cut(s) 112, 541
Hin1II CATG 2 cut(s) 239, 512
Hin6I GCGC 2 cut(s) 110, 539
HinP1I GCGC 2 cut(s) 110, 539
HindIII AAGCTT 4 cut(s) 14, 54, 117, 576
HinfI GANTC 2 cut(s) 74, 364
Hpy166II GTNNAC 1 cut(s) 492
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 442
Hpy8I GTNNAC 1 cut(s) 492
HpyCH4III ACNGT 2 cut(s) 398, 452
HpyCH4V TGCA 8 cut(s) 23, 135, 170, 243, 249, 379, 534, 573
HpyF10VI GCNNNNNNNGC 3 cut(s) 109, 116, 217
Hsp92II CATG 2 cut(s) 239, 512
HspAI GCGC 2 cut(s) 110, 539
Kzo9I GATC 2 cut(s) 7, 205
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 89, 210, 471, 520
LweI GCATC 2 cut(s) 10, 521
MaeI CTAG 1 cut(s) 495
MaeIII GTNAC 3 cut(s) 410, 446, 452
MalI GATC 2 cut(s) 9, 207
MboI GATC 2 cut(s) 7, 205
MboII GAAGA 3 cut(s) 52, 536, 560
MhlI GDGCHC 1 cut(s) 568
MluCI AATT 5 cut(s) 173, 186, 313, 355, 388
MnlI CCTC 7 cut(s) 58, 85, 172, 298, 412, 466, 538
MseI TTAA 1 cut(s) 114
MslI CAYNNNNRTG 1 cut(s) 507
MwoI GCNNNNNNNGC 3 cut(s) 109, 116, 217
NdeII GATC 2 cut(s) 7, 205
NlaIII CATG 2 cut(s) 239, 512
NmuCI GTSAC 1 cut(s) 452
NspI RCATGY 1 cut(s) 239
PaeR7I CTCGAG 2 cut(s) 470, 542
PciI ACATGT 1 cut(s) 235
PfeI GAWTC 2 cut(s) 74, 364
PscI ACATGT 1 cut(s) 235
Psp124BI GAGCTC 1 cut(s) 568
PspXI VCTCGAGB 2 cut(s) 470, 542
RsaI GTAC 2 cut(s) 323, 329
RsaNI GTAC 2 cut(s) 322, 328
RseI CAYNNNNRTG 1 cut(s) 507
SacI GAGCTC 1 cut(s) 568
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 2 cut(s) 7, 205
SduI GDGCHC 1 cut(s) 568
SetI ASST 8 cut(s) 18, 58, 121, 196, 303, 477, 568, 580
SfaNI GCATC 2 cut(s) 10, 521
SfcI CTRYAG 1 cut(s) 430
Sfr274I CTCGAG 2 cut(s) 470, 542
SlaI CTCGAG 2 cut(s) 470, 542
SmiMI CAYNNNNRTG 1 cut(s) 507
SmlI CTYRAG 4 cut(s) 51, 302, 470, 542
SmoI CTYRAG 4 cut(s) 51, 302, 470, 542
SpeI ACTAGT 1 cut(s) 494
Sse9I AATT 5 cut(s) 173, 186, 313, 355, 388
SspMI CTAG 1 cut(s) 495
SstI GAGCTC 1 cut(s) 568
TaaI ACNGT 2 cut(s) 398, 452
TaqI TCGA 3 cut(s) 471, 543, 562
TasI AATT 5 cut(s) 173, 186, 313, 355, 388
TfiI GAWTC 2 cut(s) 74, 364
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 3 cut(s) 315, 457, 575
TseFI GTSAC 1 cut(s) 452
Tsp45I GTSAC 1 cut(s) 452
TspDTI ATGAA 3 cut(s) 59, 309, 537
TspRI CASTG 3 cut(s) 315, 457, 575
XapI RAATTY 2 cut(s) 173, 313
XceI RCATGY 1 cut(s) 239
XhoI CTCGAG 2 cut(s) 470, 542
XspI CTAG 1 cut(s) 495
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.