Rh1DG360500

Clathrin is the major protein of the polyhedral coat of coated pits and vesicles

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
58569157 .. 58604355
35199 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG360500.1

Sequence Viewer

Length: 345 bp
ATGAGTTTGACTGTGTCTGTAGGGAAGCCATCTTTTACAAAGAAACAAGCAGATCTTTTCTTTCCTCCAGATTTCGCAGATGATTTCCCAGTTGCCATGCAGTACAGTAACAAGTCCTATACACCAGCATTTATCAATAAGGGCCTCATATCTAAAGCTTACACTCCTAAACTCAGAGAAGCTGTTAAGCGTTTGCAAGCAGAGAAAAAGGAAGCCAAAATTGAGGATGAGCCACAAAAGGAGAAGTTTGAAGTTCACCAGGAGAAAATGACGATTAGGAAAAGGAATTGGTGTAAAATATGGGTTTGTAGATCATATATGAATTCTAATATGTACCAATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

114

Amino Acids

13.47

Weight (kDa)

9.52

Isoelectric Point (pI)

50.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 322
AfaI GTAC 2 cut(s) 104, 335
AgsI TTSAA 1 cut(s) 251
AjnI CCWGG 1 cut(s) 258
AluBI AGCT 2 cut(s) 158, 182
AluI AGCT 2 cut(s) 158, 182
AoxI GGCC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 322
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 248
BccI CCATC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 260
BfmI CTRYAG 1 cut(s) 18
BglII AGATCT 1 cut(s) 52
Bme1390I CCNGG 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 260
BmrI ACTGGG 1 cut(s) 83
BmuI ACTGGG 1 cut(s) 83
BpmI CTGGAG 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 89
BseBI CCWGG 1 cut(s) 260
BseGI GGATG 1 cut(s) 232
BseMII CTCAG 1 cut(s) 187
BseNI ACTGG 1 cut(s) 89
BshFI GGCC 1 cut(s) 144
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 2 cut(s) 52, 311
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 186
BsrI ACTGG 1 cut(s) 89
BssMI GATC 2 cut(s) 52, 311
Bst2UI CCWGG 1 cut(s) 260
Bst4CI ACNGT 2 cut(s) 13, 107
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 232
BstKTI GATC 2 cut(s) 55, 314
BstMBI GATC 2 cut(s) 52, 311
BstNI CCWGG 1 cut(s) 260
BstSCI CCNGG 1 cut(s) 258
BstSFI CTRYAG 1 cut(s) 18
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 1 cut(s) 232
Cac8I GCNNGC 1 cut(s) 198
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 2 cut(s) 103, 334
CviAII CATG 1 cut(s) 97
CviJI RGCY 6 cut(s) 28, 144, 158, 182, 215, 232
CviKI_1 RGCY 6 cut(s) 28, 144, 158, 182, 215, 232
CviQI GTAC 2 cut(s) 103, 334
DdeI CTNAG 1 cut(s) 173
DpnI GATC 2 cut(s) 54, 313
DpnII GATC 2 cut(s) 52, 311
EcoO109I RGGNCCY 1 cut(s) 142
EcoRI GAATTC 1 cut(s) 322
EcoRII CCWGG 1 cut(s) 258
FaeI CATG 1 cut(s) 100
FaiI YATR 8 cut(s) 98, 120, 149, 301, 316, 318, 320, 332
FalI AAGNNNNNCTT 2 cut(s) 39, 71
FatI CATG 1 cut(s) 96
FokI GGATG 1 cut(s) 239
GsuI CTGGAG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 1 cut(s) 100
HindIII AAGCTT 1 cut(s) 156
HphI GGTGA 1 cut(s) 248
Hpy166II GTNNAC 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 176
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 256
HpyCH4III ACNGT 2 cut(s) 13, 107
HpyCH4V TGCA 2 cut(s) 100, 196
HpyF3I CTNAG 1 cut(s) 173
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 2 cut(s) 52, 311
LpnPI CCDG 5 cut(s) 81, 102, 138, 245, 272
MaeIII GTNAC 1 cut(s) 107
MalI GATC 2 cut(s) 54, 313
MboI GATC 2 cut(s) 52, 311
MflI RGATCY 1 cut(s) 52
MluCI AATT 3 cut(s) 219, 286, 322
MnlI CCTC 3 cut(s) 75, 155, 217
MseI TTAA 1 cut(s) 186
MspR9I CCNGG 1 cut(s) 260
MvaI CCWGG 1 cut(s) 260
NdeII GATC 2 cut(s) 52, 311
NlaIII CATG 1 cut(s) 100
PflFI GACNNNGTC 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 258
PspGI CCWGG 1 cut(s) 258
PspPI GGNCC 1 cut(s) 142
PsuI RGATCY 1 cut(s) 52
PsyI GACNNNGTC 1 cut(s) 13
RsaI GTAC 2 cut(s) 104, 335
RsaNI GTAC 2 cut(s) 103, 334
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 2 cut(s) 52, 311
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 260
SetI ASST 2 cut(s) 160, 184
SfcI CTRYAG 1 cut(s) 18
SgeI CNNG 9 cut(s) 59, 80, 101, 109, 124, 137, 209, 271, 272
Sse9I AATT 3 cut(s) 219, 286, 322
SspI AATATT 1 cut(s) 341
StyD4I CCNGG 1 cut(s) 258
TaaI ACNGT 2 cut(s) 13, 107
TasI AATT 3 cut(s) 219, 286, 322
TatI WGTACW 1 cut(s) 102
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TspDTI ATGAA 1 cut(s) 335
Tth111I GACNNNGTC 1 cut(s) 13
XapI RAATTY 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.