Rmu_sc0005581.1_g000007

Serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005581.1
OG0000484
Physical Location & Seq
Forward (+)
28499 .. 30313
1815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005581.1_g000007.1.cds

Sequence Viewer

Length: 1044 bp
atggattggtcaaatgggtgtgtgagaaagactccgctagattgcaatgacgacaagtttctgaagtactctggtgtcaaatttccaaacacagaacaatcctggtttaacagacatcctgaagactatacaaagatcaatggtaaacctactaatttcaatgtgaagaaaaggaggatcatattaatctgtatcgtgccatctactggactgctgatcctgggcctagccttctgtctatacatttgcgagaagaaacgtcgaaaagatggaaaactgtggcacagcaagaaggaagatctggaattaccattgtttgacttggctactattgtctatgcaacctgtaacttttcaaaccacaataagcttggagaaggtggttttggatgtgtctttaagggtatgttgagaaatgggcaagaaatagctgtcaaaaggctctcaaaacattctacacaaggagtaaatgagttcaagaatgaagttacacatattgctaaacttcagcacaggaatctagtgaagctccttggatgctgcattcaagcagacgaaatgatgctcatctatgaatgcatgcctaacaaaagcttggacttctttatttttgatcaaagaaaaagcatgctacttgattggcctaagcgctttggcatcatcaatggtattgctcgggggctcctctatcttcatcaagattctagattgagaataattcatagagatctcaaagctggcaatgttttattagacaatgaatttaaccccaagatctcagactttggtctagctagaagttttggaggaaacgaaactgtagcagaaatggtgagagtggttggaacctatggttacatgtccccagaatatgcaagtgacgggttctactctaccaaatctgacgcctttagctttggtgtttcggtgttggagataataagtgggaagagaaacagaagattctctcatccagaccacgaccttaaccttcttggacatgtgagtttcagctgcaaagttcaagatttaatttttgcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase Pkinase_Tyr S_locus_glycop

Protein Analysis

347

Amino Acids

39.64

Weight (kDa)

9.13

Isoelectric Point (pI)

39.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000484)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G27290 AT4G27290
fragaria_vesca FvH4_3g15690 FvH4_3g15690 FvH4_3g15690 FvH4_3g15690 FvH4_3g15690 FvH4_3g15690 FvH4_3g15690 FvH4_3g15690 FvH4_3g21310 FvH4_3g21310
malus_domestica MD05G1219900.v1.1 MD05G1220200.v1.1 MD05G1230800.v1.1 MD05G1231100.v1.1 MD05G1231700.v1.1 MD05G1232100.v1.1 MD05G1232400.v1.1 MD05G1233000.v1.1 MD10G1202800.v1.1
prunus_persica Prupe.4G139500_v2.0.a1 Prupe.4G139500_v2.0.a1
pyrus_communis pycom05g20170 pycom05g20200 pycom05g20230 pycom05g20250 pycom05g20260 pycom05g20280 pycom05g20320 pycom05g20370 pycom05g20380 pycom05g24850 pycom10g17340
rosa_chinensis RchiOBHm_Chr5g0026351 RchiOBHm_Chr5g0026371 RchiOBHm_Chr5g0026381 RchiOBHm_Chr5g0026411 RchiOBHm_Chr5g0026551 RchiOBHm_Chr5g0036371
rosa_laevigata RLG00000032923 RLG00000032926 RLG00000032927 RLG00000032928 RLG00000032934 RLG00000033692
rosa_multiflora Rmu_co8389779.1_g000001 Rmu_sc0000712.1_g000012 Rmu_sc0001017.1_g000026 Rmu_sc0001114.1_g000001 Rmu_sc0001114.1_g000002 Rmu_sc0001114.1_g000008 Rmu_sc0005581.1_g000006 Rmu_sc0005581.1_g000007 Rmu_sc0006059.1_g000052 Rmu_sc0042966.1_g000001
rosa_roxburghii Rroxscaffold_1G00044440 Rroxscaffold_1G00052930 Rroxscaffold_1G00052980 Rroxscaffold_1G00052990 Rroxscaffold_1G00053000
rosa_rugosa Rorug05G0092500 Rorug05G0092500 Rorug05G0092500 Rorug05G0092600 Rorug05G0092700 Rorug05G0092700 Rorug05G0093700 Rorug05G0155200 Rorug05G0155800 Rorug05G0155800
rosa_samantha Rh5AG185700 Rh5AG186300 Rh5BG182600 Rh5BG182900 Rh5BG183600 Rh5BG249400 Rh5CG202000 Rh5CG202100 Rh5CG202200 Rh5CG203400 Rh5CG281200 Rh5DG184400 Rh5DG184500 Rh5DG185900
rosa_wichuraiana Rw5G016850 Rw5G016870 Rw5G016930 Rw5G022870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 206
AciI CCGC 1 cut(s) 35
AclWI GGATC 2 cut(s) 185, 211
AcsI RAATTY 2 cut(s) 80, 761
AcuI CTGAAG 3 cut(s) 83, 141, 491
AcyI GRCGYC 1 cut(s) 906
AfaI GTAC 1 cut(s) 68
AfeI AGCGCT 1 cut(s) 650
AfiI CCNNNNNNNGG 1 cut(s) 206
AflIII ACRYGT 2 cut(s) 858, 1000
AgsI TTSAA 5 cut(s) 160, 357, 478, 548, 1025
AjnI CCWGG 2 cut(s) 101, 219
AjuI GAANNNNNNNTTGG 2 cut(s) 369, 401
AluBI AGCT 8 cut(s) 370, 431, 529, 594, 737, 794, 915, 1014
AluI AGCT 8 cut(s) 370, 431, 529, 594, 737, 794, 915, 1014
AlwI GGATC 2 cut(s) 185, 211
Ama87I CYCGRG 1 cut(s) 675
Aor51HI AGCGCT 1 cut(s) 650
AoxI GGCC 2 cut(s) 223, 641
ApeKI GCWGC 2 cut(s) 540, 1014
ApoI RAATTY 2 cut(s) 80, 761
AseI ATTAAT 1 cut(s) 185
AspLEI GCGC 1 cut(s) 651
AspS9I GGNCC 1 cut(s) 223
AsuHPI GGTGA 1 cut(s) 844
AvaI CYCGRG 1 cut(s) 675
BanII GRGCYC 1 cut(s) 684
BbsI GAAGAC 1 cut(s) 129
BbvI GCAGC 2 cut(s) 527, 1001
BccI CCATC 2 cut(s) 208, 263
BciT130I CCWGG 2 cut(s) 103, 221
BclI TGATCA 1 cut(s) 613
BfaI CTAG 6 cut(s) 38, 227, 521, 705, 791, 795
BfmI CTRYAG 1 cut(s) 819
BfoI RGCGCY 1 cut(s) 652
BglII AGATCT 3 cut(s) 298, 727, 774
BisI GCNGC 2 cut(s) 541, 1015
BlsI GCNGC 2 cut(s) 542, 1016
BmcAI AGTACT 1 cut(s) 68
Bme1390I CCNGG 2 cut(s) 103, 221
BmeT110I CYCGRG 1 cut(s) 675
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 2 cut(s) 683, 847
BmrFI CCNGG 2 cut(s) 103, 221
BmsI GCATC 3 cut(s) 527, 552, 666
BoxI GACNNNNGTC 1 cut(s) 786
BpiI GAAGAC 1 cut(s) 129
BplI GAGNNNNNCTC 2 cut(s) 16, 48
Bpu10I CCTNAGC 1 cut(s) 645
BsaBI GATNNNNATC 1 cut(s) 566
BsaHI GRCGYC 1 cut(s) 906
BsaJI CCNNGG 2 cut(s) 220, 532
Bsc4I CCNNNNNNNGG 1 cut(s) 206
Bse1I ACTGG 1 cut(s) 211
Bse3DI GCAATG 2 cut(s) 52, 748
Bse8I GATNNNNATC 1 cut(s) 566
BseBI CCWGG 2 cut(s) 103, 221
BseDI CCNNGG 2 cut(s) 220, 532
BseGI GGATG 4 cut(s) 115, 395, 542, 970
BseJI GATNNNNATC 1 cut(s) 566
BseLI CCNNNNNNNGG 1 cut(s) 206
BseMI GCAATG 2 cut(s) 52, 748
BseMII CTCAG 1 cut(s) 792
BseNI ACTGG 1 cut(s) 211
BseRI GAGGAG 1 cut(s) 674
BseXI GCAGC 2 cut(s) 527, 1001
BshFI GGCC 2 cut(s) 225, 643
BsiHKCI CYCGRG 1 cut(s) 675
BslFI GGGAC 1 cut(s) 847
BslI CCNNNNNNNGG 1 cut(s) 206
BsmFI GGGAC 1 cut(s) 847
BsmI GAATGC 2 cut(s) 543, 581
BsnI GGCC 2 cut(s) 225, 643
BsoBI CYCGRG 1 cut(s) 675
Bsp1286I GDGCHC 1 cut(s) 684
Bsp143I GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
BspACI CCGC 1 cut(s) 35
BspANI GGCC 2 cut(s) 225, 643
BspCNI CTCAG 1 cut(s) 791
BspLI GGNNCC 2 cut(s) 683, 847
BspPI GGATC 2 cut(s) 185, 211
BsrDI GCAATG 2 cut(s) 52, 748
BsrI ACTGG 1 cut(s) 211
BssECI CCNNGG 2 cut(s) 220, 532
BssMI GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
BssNI GRCGYC 1 cut(s) 906
BssT1I CCWWGG 1 cut(s) 532
Bst2UI CCWGG 2 cut(s) 103, 221
Bst4CI ACNGT 2 cut(s) 279, 820
Bst6I CTCTTC 1 cut(s) 944
BstACI GRCGYC 1 cut(s) 906
BstC8I GCNNGC 3 cut(s) 581, 629, 739
BstDEI CTNAG 2 cut(s) 645, 778
BstF5I GGATG 4 cut(s) 115, 395, 542, 970
BstH2I RGCGCY 1 cut(s) 652
BstHHI GCGC 1 cut(s) 651
BstKTI GATC 7 cut(s) 138, 180, 219, 301, 616, 730, 777
BstMBI GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
BstNI CCWGG 2 cut(s) 103, 221
BstNSI RCATGY 4 cut(s) 583, 631, 862, 1004
BstPAI GACNNNNGTC 1 cut(s) 786
BstSCI CCNGG 2 cut(s) 101, 219
BstSFI CTRYAG 1 cut(s) 819
BstV1I GCAGC 2 cut(s) 527, 1001
BstV2I GAAGAC 1 cut(s) 129
BstX2I RGATCY 3 cut(s) 298, 727, 774
BstYI RGATCY 3 cut(s) 298, 727, 774
BsuRI GGCC 2 cut(s) 225, 643
BtsCI GGATG 4 cut(s) 115, 395, 542, 970
Cac8I GCNNGC 3 cut(s) 581, 629, 739
CfoI GCGC 1 cut(s) 651
Cfr13I GGNCC 1 cut(s) 223
CseI GACGC 1 cut(s) 914
Csp6I GTAC 1 cut(s) 67
CviAII CATG 4 cut(s) 580, 628, 859, 1001
CviQI GTAC 1 cut(s) 67
DdeI CTNAG 2 cut(s) 645, 778
DpnI GATC 7 cut(s) 137, 179, 218, 300, 615, 729, 776
DpnII GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
Eam1104I CTCTTC 1 cut(s) 944
EarI CTCTTC 1 cut(s) 944
Eco130I CCWWGG 1 cut(s) 532
Eco24I GRGCYC 1 cut(s) 684
Eco47III AGCGCT 1 cut(s) 650
Eco57I CTGAAG 3 cut(s) 83, 141, 491
Eco88I CYCGRG 1 cut(s) 675
EcoRII CCWGG 2 cut(s) 101, 219
EcoT14I CCWWGG 1 cut(s) 532
EcoT22I ATGCAT 1 cut(s) 581
EcoT38I GRGCYC 1 cut(s) 684
ErhI CCWWGG 1 cut(s) 532
FaeI CATG 4 cut(s) 583, 631, 862, 1004
FaqI GGGAC 1 cut(s) 847
FatI CATG 4 cut(s) 579, 627, 858, 1000
FbaI TGATCA 1 cut(s) 613
Fnu4HI GCNGC 2 cut(s) 541, 1015
FokI GGATG 4 cut(s) 102, 402, 549, 957
FriOI GRGCYC 1 cut(s) 684
Fsp4HI GCNGC 2 cut(s) 541, 1015
FspBI CTAG 6 cut(s) 38, 227, 521, 705, 791, 795
GlaI GCGC 1 cut(s) 650
GluI GCNGC 2 cut(s) 541, 1015
HaeII RGCGCY 1 cut(s) 652
HaeIII GGCC 2 cut(s) 225, 643
HgaI GACGC 1 cut(s) 914
HhaI GCGC 1 cut(s) 651
Hin1I GRCGYC 1 cut(s) 906
Hin1II CATG 4 cut(s) 583, 631, 862, 1004
Hin6I GCGC 1 cut(s) 649
HinP1I GCGC 1 cut(s) 649
HindIII AAGCTT 2 cut(s) 368, 592
HinfI GANTC 4 cut(s) 31, 517, 701, 963
HphI GGTGA 1 cut(s) 844
Hpy166II GTNNAC 1 cut(s) 146
Hpy188I TCNGA 3 cut(s) 63, 781, 904
Hpy188III TCNNGA 7 cut(s) 119, 302, 478, 698, 705, 974, 1025
Hpy8I GTNNAC 1 cut(s) 146
Hpy99I CGWCG 1 cut(s) 264
HpyAV CCTTC 4 cut(s) 241, 286, 371, 1001
HpyCH4III ACNGT 2 cut(s) 279, 820
HpyCH4IV ACGT 1 cut(s) 259
HpyCH4V TGCA 6 cut(s) 45, 341, 543, 579, 875, 1017
HpyF3I CTNAG 2 cut(s) 645, 778
HpySE526I ACGT 1 cut(s) 259
Hsp92I GRCGYC 1 cut(s) 906
Hsp92II CATG 4 cut(s) 583, 631, 862, 1004
HspAI GCGC 1 cut(s) 649
Ksp22I TGATCA 1 cut(s) 613
Kzo9I GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
LmnI GCTCC 2 cut(s) 534, 687
Lsp1109I GCAGC 2 cut(s) 527, 1001
LweI GCATC 3 cut(s) 527, 552, 666
MaeI CTAG 6 cut(s) 38, 227, 521, 705, 791, 795
MaeII ACGT 1 cut(s) 259
MaeIII GTNAC 4 cut(s) 347, 487, 854, 878
MalI GATC 7 cut(s) 137, 179, 218, 300, 615, 729, 776
MboI GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
MboII GAAGA 7 cut(s) 134, 178, 265, 308, 683, 961, 972
MflI RGATCY 3 cut(s) 298, 727, 774
MhlI GDGCHC 1 cut(s) 684
MluCI AATT 6 cut(s) 80, 154, 305, 717, 761, 1032
MlyI GAGTC 1 cut(s) 25
MmeI TCCRAC 2 cut(s) 823, 912
MnlI CCTC 3 cut(s) 168, 695, 800
Mph1103I ATGCAT 1 cut(s) 581
MseI TTAA 6 cut(s) 108, 185, 399, 765, 987, 1031
MspA1I CMGCKG 1 cut(s) 1014
MspR9I CCNGG 2 cut(s) 103, 221
Mva1269I GAATGC 2 cut(s) 543, 581
MvaI CCWGG 2 cut(s) 103, 221
NdeII GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
NlaIII CATG 4 cut(s) 583, 631, 862, 1004
NlaIV GGNNCC 2 cut(s) 683, 847
NmuCI GTSAC 1 cut(s) 878
NsiI ATGCAT 1 cut(s) 581
NspI RCATGY 4 cut(s) 583, 631, 862, 1004
PaeI GCATGC 2 cut(s) 583, 631
PciI ACATGT 2 cut(s) 858, 1000
PctI GAATGC 2 cut(s) 543, 581
PfeI GAWTC 3 cut(s) 517, 701, 963
PflMI CCANNNNNTGG 1 cut(s) 206
PkrI GCNGC 2 cut(s) 542, 1016
PleI GAGTC 1 cut(s) 25
PpsI GAGTC 1 cut(s) 25
PscI ACATGT 2 cut(s) 858, 1000
PshAI GACNNNNGTC 1 cut(s) 786
PshBI ATTAAT 1 cut(s) 185
Psp6I CCWGG 2 cut(s) 101, 219
PspGI CCWGG 2 cut(s) 101, 219
PspN4I GGNNCC 2 cut(s) 683, 847
PspPI GGNCC 1 cut(s) 223
PsuI RGATCY 3 cut(s) 298, 727, 774
PvuII CAGCTG 1 cut(s) 1014
RsaI GTAC 1 cut(s) 68
RsaNI GTAC 1 cut(s) 67
SaqAI TTAA 6 cut(s) 108, 185, 399, 765, 987, 1031
SatI GCNGC 2 cut(s) 541, 1015
Sau3AI GATC 7 cut(s) 135, 177, 216, 298, 613, 727, 774
Sau96I GGNCC 1 cut(s) 223
ScaI AGTACT 1 cut(s) 68
SchI GAGTC 1 cut(s) 25
ScrFI CCNGG 2 cut(s) 103, 221
SduI GDGCHC 1 cut(s) 684
SfaNI GCATC 3 cut(s) 527, 552, 666
SfcI CTRYAG 1 cut(s) 819
SphI GCATGC 2 cut(s) 583, 631
Sse9I AATT 6 cut(s) 80, 154, 305, 717, 761, 1032
SsiI CCGC 1 cut(s) 35
SspMI CTAG 6 cut(s) 38, 227, 521, 705, 791, 795
StyD4I CCNGG 2 cut(s) 101, 219
StyI CCWWGG 1 cut(s) 532
TaaI ACNGT 2 cut(s) 279, 820
TaiI ACGT 1 cut(s) 262
TaqI TCGA 1 cut(s) 262
TasI AATT 6 cut(s) 80, 154, 305, 717, 761, 1032
TatI WGTACW 1 cut(s) 66
TfiI GAWTC 3 cut(s) 517, 701, 963
Tru1I TTAA 6 cut(s) 108, 185, 399, 765, 987, 1031
Tru9I TTAA 6 cut(s) 108, 185, 399, 765, 987, 1031
TseFI GTSAC 1 cut(s) 878
TseI GCWGC 2 cut(s) 540, 1014
Tsp45I GTSAC 1 cut(s) 878
TspDTI ATGAA 5 cut(s) 498, 588, 683, 710, 774
Van91I CCANNNNNTGG 1 cut(s) 206
VspI ATTAAT 1 cut(s) 185
XapI RAATTY 2 cut(s) 80, 761
XbaI TCTAGA 1 cut(s) 704
XceI RCATGY 4 cut(s) 583, 631, 862, 1004
XcmI CCANNNNNNNNNTGG 1 cut(s) 368
XspI CTAG 6 cut(s) 38, 227, 521, 705, 791, 795
ZrmI AGTACT 1 cut(s) 68
Zsp2I ATGCAT 1 cut(s) 581
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.