Rroxscaffold_1G00000490

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
922052 .. 922342
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00000490.1

Sequence Viewer

Length: 291 bp
ATGACCTTCTATCAATCCACCCCATTGCGTATTCCATTTAAAAATTCTGGAATCCCAACTTTCTCCAAGTATGGGGTTGATTTGGTGGAGAATCTGGCAAGCCTAGTTGTTGAATGCGGCGTCAAAATTTTTTTGGTGTGGAATAGTATTTGTCACAGATCTACAGGTTTTGAGCAAGCTATCCAAGCCTATGCAGTTCATGTTCTTTCCATGACTTACCAAAAGGTTCCCAGATCTGTGCTTGTTGAGGCAATCAACCGTGAAGGTCTATCCTTTGGACAAATTCCTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.74

Weight (kDa)

8.69

Isoelectric Point (pI)

39.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 117
AcsI RAATTY 3 cut(s) 43, 126, 282
AcyI GRCGYC 1 cut(s) 120
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
ApoI RAATTY 3 cut(s) 43, 126, 282
BfaI CTAG 1 cut(s) 104
BfmI CTRYAG 1 cut(s) 162
BglII AGATCT 2 cut(s) 158, 233
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 228
BsaHI GRCGYC 1 cut(s) 120
Bsc4I CCNNNNNNNGG 1 cut(s) 72
Bse3DI GCAATG 1 cut(s) 23
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMI GCAATG 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 72
BsmI GAATGC 1 cut(s) 119
Bsp143I GATC 2 cut(s) 158, 233
BspACI CCGC 1 cut(s) 117
BspLI GGNNCC 1 cut(s) 228
BsrDI GCAATG 1 cut(s) 23
BssMI GATC 2 cut(s) 158, 233
BssNI GRCGYC 1 cut(s) 120
Bst4CI ACNGT 1 cut(s) 260
BstACI GRCGYC 1 cut(s) 120
BstC8I GCNNGC 2 cut(s) 100, 177
BstKTI GATC 2 cut(s) 161, 236
BstMBI GATC 2 cut(s) 158, 233
BstMWI GCNNNNNNNGC 1 cut(s) 185
BstSFI CTRYAG 1 cut(s) 162
BstX2I RGATCY 2 cut(s) 158, 233
BstYI RGATCY 2 cut(s) 158, 233
Cac8I GCNNGC 2 cut(s) 100, 177
CseI GACGC 1 cut(s) 109
CviAII CATG 2 cut(s) 200, 211
CviJI RGCY 3 cut(s) 102, 179, 188
CviKI_1 RGCY 3 cut(s) 102, 179, 188
DpnI GATC 2 cut(s) 160, 235
DpnII GATC 2 cut(s) 158, 233
DraI TTTAAA 1 cut(s) 40
FaeI CATG 2 cut(s) 203, 214
FaiI YATR 4 cut(s) 72, 192, 201, 212
FatI CATG 2 cut(s) 199, 210
Fnu4HI GCNGC 1 cut(s) 118
Fsp4HI GCNGC 1 cut(s) 118
FspBI CTAG 1 cut(s) 104
GluI GCNGC 1 cut(s) 118
HgaI GACGC 1 cut(s) 109
Hin1I GRCGYC 1 cut(s) 120
Hin1II CATG 2 cut(s) 203, 214
HinfI GANTC 2 cut(s) 51, 91
Hpy188III TCNNGA 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 16, 257
HpyCH4III ACNGT 1 cut(s) 260
HpyCH4V TGCA 1 cut(s) 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 185
Hsp92I GRCGYC 1 cut(s) 120
Hsp92II CATG 2 cut(s) 203, 214
Kzo9I GATC 2 cut(s) 158, 233
LpnPI CCDG 4 cut(s) 33, 80, 150, 244
MaeI CTAG 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 152
MalI GATC 2 cut(s) 160, 235
MboI GATC 2 cut(s) 158, 233
MflI RGATCY 2 cut(s) 158, 233
MluCI AATT 3 cut(s) 43, 126, 282
MnlI CCTC 1 cut(s) 241
MseI TTAA 2 cut(s) 39, 289
Mva1269I GAATGC 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 185
NdeII GATC 2 cut(s) 158, 233
NlaIII CATG 2 cut(s) 203, 214
NlaIV GGNNCC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 152
PctI GAATGC 1 cut(s) 119
PfeI GAWTC 2 cut(s) 51, 91
PkrI GCNGC 1 cut(s) 119
PspN4I GGNNCC 1 cut(s) 228
PsuI RGATCY 2 cut(s) 158, 233
SaqAI TTAA 2 cut(s) 39, 289
SatI GCNGC 1 cut(s) 118
Sau3AI GATC 2 cut(s) 158, 233
SetI ASST 5 cut(s) 8, 169, 181, 228, 268
SfcI CTRYAG 1 cut(s) 162
Sse9I AATT 3 cut(s) 43, 126, 282
SsiI CCGC 1 cut(s) 117
SspMI CTAG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 260
TasI AATT 3 cut(s) 43, 126, 282
TauI GCSGC 1 cut(s) 120
TfiI GAWTC 2 cut(s) 51, 91
Tru1I TTAA 2 cut(s) 39, 289
Tru9I TTAA 2 cut(s) 39, 289
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
TspDTI ATGAA 1 cut(s) 188
XapI RAATTY 3 cut(s) 43, 126, 282
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.