Rh5BG568100

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
89768524 .. 89769136
613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG568100.1

Sequence Viewer

Length: 291 bp
ATGACCTTCCATCAATCCAACCCATTGCCTATTCCATTTAAAAATTCCGGTATCCCAACTTTCTCCAAGTATGGGGTTGATTTGGTGGAGAATCTTGCAAGCCCAGTTGTTGAATGCGGCGTCAAAATTGTTCTGGTGTGGAATAGTATTCGTCACAGATCTACAGGTTTTGAGCAAGGTATCCAAGCCTATGAAGTTCATGTTCTTTCCTTGACTTACCAAAAGGTTCCCAGATCTGTGCTTGCTGAGGCAATCAACCGTGAAGGTCCATCCTTTGGACAAATTCCTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.64

Weight (kDa)

7.93

Isoelectric Point (pI)

37.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 275
AciI CCGC 1 cut(s) 117
AcsI RAATTY 2 cut(s) 43, 282
AcyI GRCGYC 1 cut(s) 120
AfiI CCNNNNNNNGG 2 cut(s) 72, 275
AgsI TTSAA 1 cut(s) 113
ApoI RAATTY 2 cut(s) 43, 282
AspS9I GGNCC 1 cut(s) 266
AvaII GGWCC 1 cut(s) 266
BbvCI CCTCAGC 1 cut(s) 246
BccI CCATC 2 cut(s) 18, 277
BciVI GTATCC 2 cut(s) 62, 191
BfmI CTRYAG 1 cut(s) 162
BfuI GTATCC 2 cut(s) 62, 191
BglII AGATCT 2 cut(s) 158, 233
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
Bme18I GGWCC 1 cut(s) 266
BmgT120I GGNCC 1 cut(s) 266
BmiI GGNNCC 1 cut(s) 228
BmrI ACTGGG 1 cut(s) 98
BmuI ACTGGG 1 cut(s) 98
Bpu10I CCTNAGC 1 cut(s) 246
BsaHI GRCGYC 1 cut(s) 120
BsaWI WCCGGW 1 cut(s) 47
Bsc4I CCNNNNNNNGG 2 cut(s) 72, 275
Bse1I ACTGG 1 cut(s) 104
Bse3DI GCAATG 1 cut(s) 23
BseGI GGATG 1 cut(s) 269
BseLI CCNNNNNNNGG 2 cut(s) 72, 275
BseMI GCAATG 1 cut(s) 23
BseMII CTCAG 1 cut(s) 237
BseNI ACTGG 1 cut(s) 104
BsiSI CCGG 1 cut(s) 48
BslI CCNNNNNNNGG 2 cut(s) 72, 275
BsmI GAATGC 1 cut(s) 119
Bsp143I GATC 2 cut(s) 158, 233
BspACI CCGC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 238
BspLI GGNNCC 1 cut(s) 228
BsrDI GCAATG 1 cut(s) 23
BsrI ACTGG 1 cut(s) 104
BssMI GATC 2 cut(s) 158, 233
BssNI GRCGYC 1 cut(s) 120
Bst4CI ACNGT 1 cut(s) 260
BstACI GRCGYC 1 cut(s) 120
BstC8I GCNNGC 2 cut(s) 100, 243
BstDEI CTNAG 1 cut(s) 246
BstF5I GGATG 1 cut(s) 269
BstKTI GATC 2 cut(s) 161, 236
BstMBI GATC 2 cut(s) 158, 233
BstSFI CTRYAG 1 cut(s) 162
BstX2I RGATCY 2 cut(s) 158, 233
BstYI RGATCY 2 cut(s) 158, 233
BsuI GTATCC 2 cut(s) 62, 191
BtsCI GGATG 1 cut(s) 269
Cac8I GCNNGC 2 cut(s) 100, 243
Cfr13I GGNCC 1 cut(s) 266
CseI GACGC 1 cut(s) 109
CviAII CATG 1 cut(s) 200
CviJI RGCY 2 cut(s) 102, 188
CviKI_1 RGCY 2 cut(s) 102, 188
DdeI CTNAG 1 cut(s) 246
DpnI GATC 2 cut(s) 160, 235
DpnII GATC 2 cut(s) 158, 233
DraI TTTAAA 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 266
FaeI CATG 1 cut(s) 203
FaiI YATR 3 cut(s) 72, 192, 201
FatI CATG 1 cut(s) 199
Fnu4HI GCNGC 1 cut(s) 118
FokI GGATG 1 cut(s) 256
Fsp4HI GCNGC 1 cut(s) 118
GluI GCNGC 1 cut(s) 118
HapII CCGG 1 cut(s) 48
HgaI GACGC 1 cut(s) 109
Hin1I GRCGYC 1 cut(s) 120
Hin1II CATG 1 cut(s) 203
HinfI GANTC 1 cut(s) 91
HpaII CCGG 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 16, 257
HpyCH4III ACNGT 1 cut(s) 260
HpyCH4V TGCA 1 cut(s) 98
HpyF3I CTNAG 1 cut(s) 246
Hsp92I GRCGYC 1 cut(s) 120
Hsp92II CATG 1 cut(s) 203
Kzo9I GATC 2 cut(s) 158, 233
LpnPI CCDG 5 cut(s) 61, 117, 119, 150, 244
MaeIII GTNAC 1 cut(s) 152
MalI GATC 2 cut(s) 160, 235
MboI GATC 2 cut(s) 158, 233
MflI RGATCY 2 cut(s) 158, 233
MluCI AATT 3 cut(s) 43, 126, 282
MmeI TCCRAC 1 cut(s) 42
MnlI CCTC 1 cut(s) 241
MseI TTAA 2 cut(s) 39, 289
MspI CCGG 1 cut(s) 48
Mva1269I GAATGC 1 cut(s) 119
NdeII GATC 2 cut(s) 158, 233
NlaIII CATG 1 cut(s) 203
NlaIV GGNNCC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 152
PctI GAATGC 1 cut(s) 119
PfeI GAWTC 1 cut(s) 91
PflMI CCANNNNNTGG 1 cut(s) 275
PkrI GCNGC 1 cut(s) 119
PspN4I GGNNCC 1 cut(s) 228
PspPI GGNCC 1 cut(s) 266
PsuI RGATCY 2 cut(s) 158, 233
SaqAI TTAA 2 cut(s) 39, 289
SatI GCNGC 1 cut(s) 118
Sau3AI GATC 2 cut(s) 158, 233
Sau96I GGNCC 1 cut(s) 266
SetI ASST 5 cut(s) 8, 169, 181, 228, 268
SfcI CTRYAG 1 cut(s) 162
SinI GGWCC 1 cut(s) 266
Sse9I AATT 3 cut(s) 43, 126, 282
SsiI CCGC 1 cut(s) 117
TaaI ACNGT 1 cut(s) 260
TasI AATT 3 cut(s) 43, 126, 282
TauI GCSGC 1 cut(s) 120
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 2 cut(s) 39, 289
Tru9I TTAA 2 cut(s) 39, 289
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
TspDTI ATGAA 2 cut(s) 188, 207
Van91I CCANNNNNTGG 1 cut(s) 275
VpaK11BI GGWCC 1 cut(s) 266
XapI RAATTY 2 cut(s) 43, 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.