Rroxscaffold_3G00233540

Protein translocase subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
19591404 .. 19595434
4031 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00233540.1

Sequence Viewer

Length: 273 bp
ATGGAGGATGGAGTGAGGTGGTGGAGTGATGGACTTCACCAAGCAGTTGAAGCAAAAGAAGTTCTGTCGATTCAAAACGAAACTATAACTCTGGCATCTATCAGCTACCAAAACTTCTTTCTCCAGGATGAATCTGATGTAGTTTTCAGGGCAACTAAAGGTAAATGGCGGGCAGTTGTAGTAGAGATTTCTAGAATACACAAAACAGGTCGCCCTGTACTTGTTGGCACAACTAGTGTTGAGCAGAGTGACTCATTGTCTGAGCAGTTGTAA

Protein Analysis

90

Amino Acids

10.15

Weight (kDa)

5.02

Isoelectric Point (pI)

45.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
P-loop_SecA PF21090 42 - 90 8.2e-14 SecA P-loop domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AfaI GTAC 1 cut(s) 219
AgsI TTSAA 2 cut(s) 50, 74
AhdI GACNNNNNGTC 1 cut(s) 256
AhlI ACTAGT 1 cut(s) 233
AjnI CCWGG 1 cut(s) 123
AjuI GAANNNNNNNTTGG 2 cut(s) 102, 134
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
AsuHPI GGTGA 1 cut(s) 29
BccI CCATC 2 cut(s) 2, 23
BciT130I CCWGG 1 cut(s) 125
BcuI ACTAGT 1 cut(s) 233
BfaI CTAG 2 cut(s) 192, 234
Bme1390I CCNGG 1 cut(s) 125
BmeRI GACNNNNNGTC 1 cut(s) 256
BmrFI CCNGG 1 cut(s) 125
BmsI GCATC 1 cut(s) 104
BpmI CTGGAG 1 cut(s) 107
BseBI CCWGG 1 cut(s) 125
BseGI GGATG 2 cut(s) 13, 133
BseMII CTCAG 1 cut(s) 252
BspACI CCGC 1 cut(s) 169
BspCNI CTCAG 1 cut(s) 253
Bst2UI CCWGG 1 cut(s) 125
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 261
BstF5I GGATG 2 cut(s) 13, 133
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 125
BstSCI CCNGG 1 cut(s) 123
BtsCI GGATG 2 cut(s) 13, 133
Cac8I GCNNGC 1 cut(s) 171
Csp6I GTAC 1 cut(s) 218
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
CviQI GTAC 1 cut(s) 218
DdeI CTNAG 1 cut(s) 261
DriI GACNNNNNGTC 1 cut(s) 256
Eam1105I GACNNNNNGTC 1 cut(s) 256
EcoRII CCWGG 1 cut(s) 123
FaiI YATR 1 cut(s) 86
FauI CCCGC 1 cut(s) 162
FokI GGATG 2 cut(s) 20, 140
FspBI CTAG 2 cut(s) 192, 234
GsuI CTGGAG 1 cut(s) 107
HinfI GANTC 3 cut(s) 70, 131, 251
HphI GGTGA 1 cut(s) 29
Hpy188I TCNGA 2 cut(s) 136, 262
Hpy188III TCNNGA 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 261
LpnPI CCDG 6 cut(s) 77, 110, 133, 137, 192, 228
LweI GCATC 1 cut(s) 104
MaeI CTAG 2 cut(s) 192, 234
MaeIII GTNAC 1 cut(s) 248
MlyI GAGTC 1 cut(s) 245
MnlI CCTC 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 125
MvaI CCWGG 1 cut(s) 125
MwoI GCNNNNNNNGC 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 248
PfeI GAWTC 2 cut(s) 70, 131
PfoI TCCNGGA 1 cut(s) 123
PleI GAGTC 1 cut(s) 245
PpsI GAGTC 1 cut(s) 245
Psp6I CCWGG 1 cut(s) 123
PspGI CCWGG 1 cut(s) 123
RsaI GTAC 1 cut(s) 219
RsaNI GTAC 1 cut(s) 218
SchI GAGTC 1 cut(s) 245
ScrFI CCNGG 1 cut(s) 125
SetI ASST 4 cut(s) 20, 107, 163, 211
SfaNI GCATC 1 cut(s) 104
SpeI ACTAGT 1 cut(s) 233
SsiI CCGC 1 cut(s) 169
SspMI CTAG 2 cut(s) 192, 234
StyD4I CCNGG 1 cut(s) 123
TaqI TCGA 1 cut(s) 68
TatI WGTACW 1 cut(s) 217
TfiI GAWTC 2 cut(s) 70, 131
TseFI GTSAC 1 cut(s) 248
Tsp45I GTSAC 1 cut(s) 248
TspDTI ATGAA 1 cut(s) 144
XbaI TCTAGA 1 cut(s) 191
XspI CTAG 2 cut(s) 192, 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.