Rh5AG197000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000831
Physical Location & Seq
Forward (+)
23082537 .. 23089967
7431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG197000.1

Sequence Viewer

Length: 276 bp
ATGATTGGTCGATCATTCTTGGAGTTTGTTATCAACTTTCAAGGATACGGCGCAATGACTATACCAATAGAATATAATAATGAGTCTGGTGCATTGAATGAAGAAGTGATGGCAGCTCCAAATTTGGACAATGTTGTACCACCAGTTAATAATATTGCAGAAGTAAATGAGGAGGAAAATCATGTGCAGCAGCGGTTAGAAGATGACCAGATTAATATTCCAGTACCACCACCACCACAACACCAGGAACCAGGTTTAACGAAAGATATTCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.19

Weight (kDa)

4.18

Isoelectric Point (pI)

68.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 193
AcsI RAATTY 1 cut(s) 121
AfaI GTAC 2 cut(s) 138, 225
AgsI TTSAA 2 cut(s) 41, 97
AjnI CCWGG 2 cut(s) 243, 250
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
ApeKI GCWGC 3 cut(s) 113, 187, 190
ApoI RAATTY 1 cut(s) 121
AseI ATTAAT 1 cut(s) 213
AspLEI GCGC 1 cut(s) 53
BbvI GCAGC 3 cut(s) 125, 199, 202
BccI CCATC 1 cut(s) 103
BceAI ACGGC 1 cut(s) 64
BciT130I CCWGG 2 cut(s) 245, 252
BciVI GTATCC 1 cut(s) 38
BfuI GTATCC 1 cut(s) 38
BisI GCNGC 3 cut(s) 114, 188, 191
BlsI GCNGC 3 cut(s) 115, 189, 192
Bme1390I CCNGG 2 cut(s) 245, 252
BmiI GGNNCC 1 cut(s) 249
BmrFI CCNGG 2 cut(s) 245, 252
Bse1I ACTGG 2 cut(s) 143, 221
Bse3DI GCAATG 1 cut(s) 60
BseBI CCWGG 2 cut(s) 245, 252
BseMI GCAATG 1 cut(s) 60
BseNI ACTGG 2 cut(s) 143, 221
BseRI GAGGAG 1 cut(s) 185
BseXI GCAGC 3 cut(s) 125, 199, 202
BsgI GTGCAG 1 cut(s) 206
Bsp143I GATC 1 cut(s) 11
BspACI CCGC 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 249
BsrDI GCAATG 1 cut(s) 60
BsrI ACTGG 2 cut(s) 143, 221
BssMI GATC 1 cut(s) 11
Bst2UI CCWGG 2 cut(s) 245, 252
BstHHI GCGC 1 cut(s) 53
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstNI CCWGG 2 cut(s) 245, 252
BstSCI CCNGG 2 cut(s) 243, 250
BstV1I GCAGC 3 cut(s) 125, 199, 202
BsuI GTATCC 1 cut(s) 38
BtsIMutI CAGTG 1 cut(s) 271
CfoI GCGC 1 cut(s) 53
CsiI ACCWGGT 1 cut(s) 250
Csp6I GTAC 2 cut(s) 137, 224
CviAII CATG 1 cut(s) 182
CviJI RGCY 1 cut(s) 116
CviKI_1 RGCY 1 cut(s) 116
CviQI GTAC 2 cut(s) 137, 224
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
EcoRII CCWGG 2 cut(s) 243, 250
FaeI CATG 1 cut(s) 185
FaiI YATR 3 cut(s) 62, 75, 183
FatI CATG 1 cut(s) 181
Fnu4HI GCNGC 3 cut(s) 114, 188, 191
Fsp4HI GCNGC 3 cut(s) 114, 188, 191
GlaI GCGC 1 cut(s) 52
GluI GCNGC 3 cut(s) 114, 188, 191
HhaI GCGC 1 cut(s) 53
Hin1II CATG 1 cut(s) 185
Hin6I GCGC 1 cut(s) 51
HinP1I GCGC 1 cut(s) 51
HinfI GANTC 1 cut(s) 83
HpyCH4V TGCA 3 cut(s) 92, 158, 187
Hsp92II CATG 1 cut(s) 185
HspAI GCGC 1 cut(s) 51
Kzo9I GATC 1 cut(s) 11
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 8 cut(s) 72, 156, 221, 230, 234, 237, 257, 264
Lsp1109I GCAGC 3 cut(s) 125, 199, 202
MabI ACCWGGT 1 cut(s) 250
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 2 cut(s) 113, 212
MluCI AATT 1 cut(s) 121
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 2 cut(s) 163, 166
MseI TTAA 3 cut(s) 147, 213, 257
MspA1I CMGCKG 1 cut(s) 193
MspR9I CCNGG 2 cut(s) 245, 252
MvaI CCWGG 2 cut(s) 245, 252
NdeII GATC 1 cut(s) 11
NlaIII CATG 1 cut(s) 185
NlaIV GGNNCC 1 cut(s) 249
PkrI GCNGC 3 cut(s) 115, 189, 192
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
PshBI ATTAAT 1 cut(s) 213
Psp6I CCWGG 2 cut(s) 243, 250
PspGI CCWGG 2 cut(s) 243, 250
PspN4I GGNNCC 1 cut(s) 249
RsaI GTAC 2 cut(s) 138, 225
RsaNI GTAC 2 cut(s) 137, 224
SaqAI TTAA 3 cut(s) 147, 213, 257
SatI GCNGC 3 cut(s) 114, 188, 191
Sau3AI GATC 1 cut(s) 11
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 2 cut(s) 245, 252
SetI ASST 2 cut(s) 118, 256
SexAI ACCWGGT 1 cut(s) 250
Sse9I AATT 1 cut(s) 121
SsiI CCGC 1 cut(s) 193
SspI AATATT 2 cut(s) 154, 217
StyD4I CCNGG 2 cut(s) 243, 250
TaqI TCGA 1 cut(s) 10
TasI AATT 1 cut(s) 121
Tru1I TTAA 3 cut(s) 147, 213, 257
Tru9I TTAA 3 cut(s) 147, 213, 257
TseI GCWGC 3 cut(s) 113, 187, 190
TspDTI ATGAA 1 cut(s) 114
VspI ATTAAT 1 cut(s) 213
XapI RAATTY 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.