Rh7AG200500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0000831
Physical Location & Seq
Forward (+)
18199164 .. 18203580
4417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG200500.1

Sequence Viewer

Length: 306 bp
ATGAATGATGCTGACAATGTTATTATGGATGAGTTGGACTTAGAAGCTGCAAGAAATACAGTAAGTGACATTGATGAATGGTTCGTGTATAATGAAGAAGATAATAATGAGTTTGCTGCATTGAATGAAGAAGTGATGGCAGCTCCAAATTTGGACAATGTTGTACCACCAGTTAATAATATTGCAGAAGTAAATGAGGAGGAAAATCATGTGCAGCAGCAGTTAGAAGATGACCAGATTAATATTCCAGTACCACCACCACCACAACACCAGGAACCAGTGAATCACATGTCAAATGCTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.41

Weight (kDa)

4.05

Isoelectric Point (pI)

66.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 148
AfaI GTAC 2 cut(s) 165, 252
AflIII ACRYGT 1 cut(s) 288
AgsI TTSAA 1 cut(s) 124
AjnI CCWGG 1 cut(s) 270
AluBI AGCT 2 cut(s) 47, 143
AluI AGCT 2 cut(s) 47, 143
ApeKI GCWGC 5 cut(s) 47, 116, 140, 214, 217
ApoI RAATTY 1 cut(s) 148
AseI ATTAAT 1 cut(s) 240
BbvI GCAGC 5 cut(s) 34, 103, 152, 226, 229
BccI CCATC 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 272
BisI GCNGC 5 cut(s) 48, 117, 141, 215, 218
BlsI GCNGC 5 cut(s) 49, 118, 142, 216, 219
Bme1390I CCNGG 1 cut(s) 272
BmiI GGNNCC 1 cut(s) 276
BmrFI CCNGG 1 cut(s) 272
Bse1I ACTGG 3 cut(s) 170, 248, 278
BseBI CCWGG 1 cut(s) 272
BseGI GGATG 1 cut(s) 34
BseNI ACTGG 3 cut(s) 170, 248, 278
BseRI GAGGAG 1 cut(s) 212
BseXI GCAGC 5 cut(s) 34, 103, 152, 226, 229
BsgI GTGCAG 1 cut(s) 233
BspLI GGNNCC 1 cut(s) 276
BsrI ACTGG 3 cut(s) 170, 248, 278
Bst2UI CCWGG 1 cut(s) 272
Bst4CI ACNGT 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 40
BstF5I GGATG 1 cut(s) 34
BstNI CCWGG 1 cut(s) 272
BstNSI RCATGY 1 cut(s) 292
BstSCI CCNGG 1 cut(s) 270
BstV1I GCAGC 5 cut(s) 34, 103, 152, 226, 229
BtsCI GGATG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 285
Csp6I GTAC 2 cut(s) 164, 251
CviAII CATG 2 cut(s) 209, 289
CviJI RGCY 2 cut(s) 47, 143
CviKI_1 RGCY 2 cut(s) 47, 143
CviQI GTAC 2 cut(s) 164, 251
DdeI CTNAG 1 cut(s) 40
EcoRII CCWGG 1 cut(s) 270
FaeI CATG 2 cut(s) 212, 292
FaiI YATR 4 cut(s) 26, 90, 210, 290
FatI CATG 2 cut(s) 208, 288
Fnu4HI GCNGC 5 cut(s) 48, 117, 141, 215, 218
FokI GGATG 1 cut(s) 41
Fsp4HI GCNGC 5 cut(s) 48, 117, 141, 215, 218
GluI GCNGC 5 cut(s) 48, 117, 141, 215, 218
Hin1II CATG 2 cut(s) 212, 292
HinfI GANTC 1 cut(s) 283
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4V TGCA 4 cut(s) 50, 119, 185, 214
HpyF3I CTNAG 1 cut(s) 40
Hsp92II CATG 2 cut(s) 212, 292
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 6 cut(s) 183, 248, 257, 261, 284, 291
Lsp1109I GCAGC 5 cut(s) 34, 103, 152, 226, 229
MaeIII GTNAC 1 cut(s) 65
MboII GAAGA 4 cut(s) 107, 110, 140, 239
MluCI AATT 1 cut(s) 148
MmeI TCCRAC 1 cut(s) 15
MnlI CCTC 2 cut(s) 190, 193
MseI TTAA 3 cut(s) 174, 240, 304
MspR9I CCNGG 1 cut(s) 272
MvaI CCWGG 1 cut(s) 272
NlaIII CATG 2 cut(s) 212, 292
NlaIV GGNNCC 1 cut(s) 276
NmuCI GTSAC 1 cut(s) 65
NspI RCATGY 1 cut(s) 292
PciI ACATGT 1 cut(s) 288
PfeI GAWTC 1 cut(s) 283
PkrI GCNGC 5 cut(s) 49, 118, 142, 216, 219
PscI ACATGT 1 cut(s) 288
PshBI ATTAAT 1 cut(s) 240
Psp6I CCWGG 1 cut(s) 270
PspGI CCWGG 1 cut(s) 270
PspN4I GGNNCC 1 cut(s) 276
RsaI GTAC 2 cut(s) 165, 252
RsaNI GTAC 2 cut(s) 164, 251
SaqAI TTAA 3 cut(s) 174, 240, 304
SatI GCNGC 5 cut(s) 48, 117, 141, 215, 218
ScrFI CCNGG 1 cut(s) 272
SetI ASST 2 cut(s) 49, 145
Sse9I AATT 1 cut(s) 148
SspI AATATT 2 cut(s) 181, 244
StyD4I CCNGG 1 cut(s) 270
TaaI ACNGT 1 cut(s) 61
TasI AATT 1 cut(s) 148
TfiI GAWTC 1 cut(s) 283
Tru1I TTAA 3 cut(s) 174, 240, 304
Tru9I TTAA 3 cut(s) 174, 240, 304
TscAI CASTG 1 cut(s) 285
TseFI GTSAC 1 cut(s) 65
TseI GCWGC 5 cut(s) 47, 116, 140, 214, 217
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 4 cut(s) 17, 90, 108, 141
TspRI CASTG 1 cut(s) 285
VspI ATTAAT 1 cut(s) 240
XapI RAATTY 1 cut(s) 148
XceI RCATGY 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.