Rroxscaffold_7G00208540

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0001209
Physical Location & Seq
Reverse (-)
58545585 .. 58547579
1995 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00208540.1

Sequence Viewer

Length: 177 bp
ATGCCGGTACTTGAGGTCAAGAAGCATGGGGTGTGGCTTTTACCAAAAAATTTAAGTAAAGCAATGTGCAACCCTAGTGCTAATGTTTCAATGTGGTTTATAATTATTTCCAGATGTCTTGGAAATAATTGGAAGAGACTTGATAATGTTTTAGGGTGTGAGAATGACTCTATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.58

Weight (kDa)

9.02

Isoelectric Point (pI)

39.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 101
AcsI RAATTY 1 cut(s) 49
AfaI GTAC 1 cut(s) 9
AgsI TTSAA 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 130
BfaI CTAG 2 cut(s) 75, 175
BplI GAGNNNNNCTC 1 cut(s) 152
BpuEI CTTGAG 1 cut(s) 32
Bse118I RCCGGY 1 cut(s) 4
Bse3DI GCAATG 1 cut(s) 69
BseMI GCAATG 1 cut(s) 69
BsiSI CCGG 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 130
BsrDI GCAATG 1 cut(s) 69
BsrFI RCCGGY 1 cut(s) 4
BssAI RCCGGY 1 cut(s) 4
Bst6I CTCTTC 1 cut(s) 128
BstMAI GTCTC 1 cut(s) 130
Cfr10I RCCGGY 1 cut(s) 4
Csp6I GTAC 1 cut(s) 8
CviAII CATG 1 cut(s) 26
CviJI RGCY 1 cut(s) 37
CviKI_1 RGCY 1 cut(s) 37
CviQI GTAC 1 cut(s) 8
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
FaeI CATG 1 cut(s) 29
FaiI YATR 2 cut(s) 27, 101
FatI CATG 1 cut(s) 25
FspBI CTAG 2 cut(s) 75, 175
HapII CCGG 1 cut(s) 5
Hin1II CATG 1 cut(s) 29
HinfI GANTC 1 cut(s) 167
HpaII CCGG 1 cut(s) 5
Hpy188III TCNNGA 2 cut(s) 19, 111
HpyCH4V TGCA 1 cut(s) 69
Hsp92II CATG 1 cut(s) 29
LpnPI CCDG 2 cut(s) 18, 124
MaeI CTAG 2 cut(s) 75, 175
MboII GAAGA 1 cut(s) 145
MluCI AATT 3 cut(s) 49, 102, 127
MlyI GAGTC 1 cut(s) 161
MnlI CCTC 1 cut(s) 7
MseI TTAA 1 cut(s) 53
MspI CCGG 1 cut(s) 5
NlaIII CATG 1 cut(s) 29
PleI GAGTC 1 cut(s) 161
PpsI GAGTC 1 cut(s) 161
PsiI TTATAA 1 cut(s) 101
RsaI GTAC 1 cut(s) 9
RsaNI GTAC 1 cut(s) 8
SaqAI TTAA 1 cut(s) 53
SchI GAGTC 1 cut(s) 161
SetI ASST 1 cut(s) 18
SgeI CNNG 8 cut(s) 17, 23, 31, 38, 87, 123, 131, 152
SmlI CTYRAG 1 cut(s) 11
SmoI CTYRAG 1 cut(s) 11
Sse9I AATT 3 cut(s) 49, 102, 127
SspMI CTAG 2 cut(s) 75, 175
TasI AATT 3 cut(s) 49, 102, 127
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
XapI RAATTY 1 cut(s) 49
XspI CTAG 2 cut(s) 75, 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.