Rh4CG322900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0001209
Physical Location & Seq
Reverse (-)
58502912 .. 58503579
668 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG322900.1

Sequence Viewer

Length: 192 bp
ATGACCACCCCAATATTTCGGTGCTTGTTGACTCTCAAGGGTTTCGAATTTGGGGATTCTGCAACAACCTACCAAATTTCTTGCTCTCGTCAGAAATTGGAGTTTATCTCCACATGTAGATTGACTTTCTATGCCGAGTTCAGTCATTGTGATTTCAATTTAAATCGGTTGAGAATGAACTACCCGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.46

Weight (kDa)

8.84

Isoelectric Point (pI)

40.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 47, 75
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 1 cut(s) 157
ApoI RAATTY 2 cut(s) 47, 75
AsuII TTCGAA 1 cut(s) 45
BplI GAGNNNNNCTC 2 cut(s) 92, 124
Bpu14I TTCGAA 1 cut(s) 45
BpuEI CTTGAG 1 cut(s) 20
Bsp119I TTCGAA 1 cut(s) 45
BspT104I TTCGAA 1 cut(s) 45
BstBI TTCGAA 1 cut(s) 45
BstNSI RCATGY 1 cut(s) 117
CviAII CATG 1 cut(s) 114
DraI TTTAAA 1 cut(s) 162
FaeI CATG 1 cut(s) 117
FaiI YATR 2 cut(s) 115, 132
FatI CATG 1 cut(s) 113
Hin1II CATG 1 cut(s) 117
HincII GTYRAC 1 cut(s) 30
HindII GTYRAC 1 cut(s) 30
HinfI GANTC 2 cut(s) 31, 56
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 1 cut(s) 93
Hpy8I GTNNAC 1 cut(s) 30
HpyCH4V TGCA 1 cut(s) 62
Hsp92II CATG 1 cut(s) 117
MluCI AATT 4 cut(s) 47, 75, 95, 157
MlyI GAGTC 1 cut(s) 25
MseI TTAA 1 cut(s) 161
NlaIII CATG 1 cut(s) 117
NmeAIII GCCGAG 1 cut(s) 160
NspI RCATGY 1 cut(s) 117
NspV TTCGAA 1 cut(s) 45
PciI ACATGT 1 cut(s) 113
PfeI GAWTC 1 cut(s) 56
PleI GAGTC 1 cut(s) 25
PpsI GAGTC 1 cut(s) 25
PscI ACATGT 1 cut(s) 113
SaqAI TTAA 1 cut(s) 161
SchI GAGTC 1 cut(s) 25
SetI ASST 1 cut(s) 71
SfuI TTCGAA 1 cut(s) 45
SgeI CNNG 6 cut(s) 37, 49, 93, 99, 126, 148
SmiI ATTTAAAT 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
Sse9I AATT 4 cut(s) 47, 75, 95, 157
SspI AATATT 1 cut(s) 15
SwaI ATTTAAAT 1 cut(s) 162
TaqI TCGA 1 cut(s) 45
TasI AATT 4 cut(s) 47, 75, 95, 157
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 191
XapI RAATTY 2 cut(s) 47, 75
XceI RCATGY 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.