Rh2BG264700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
28423022 .. 28430152
7131 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG264700.1

Sequence Viewer

Length: 204 bp
ATGGAATTGGGCGGCAACGACCACCCTTCCGAGGTTGCAATATTTTTAATCTTAGGGGTTCGAATTAGGGGCTTCTGCAACAACCTATCAAATTTGGCTGCCCTCGTTACAAAATTGGAGTTGATCTCGACATTCAGATTGACTTTCCATGCCGAGTTCAGTCCCTGTGATATCAATTTAGATCGGTTCTGCGAAGGCCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.47

Weight (kDa)

5.08

Isoelectric Point (pI)

25.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 31
AlwNI CAGNNNCTG 1 cut(s) 165
AoxI GGCC 1 cut(s) 196
ApeKI GCWGC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 91
AsuII TTCGAA 1 cut(s) 61
BbvI GCAGC 1 cut(s) 85
BisI GCNGC 2 cut(s) 13, 99
BlsI GCNGC 2 cut(s) 14, 100
BplI GAGNNNNNCTC 2 cut(s) 110, 142
Bpu14I TTCGAA 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 31
Bse1I ACTGG 1 cut(s) 199
BseDI CCNNGG 1 cut(s) 30
BseLI CCNNNNNNNGG 1 cut(s) 31
BseNI ACTGG 1 cut(s) 199
BseXI GCAGC 1 cut(s) 85
BshFI GGCC 1 cut(s) 198
BslFI GGGAC 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 147
BsnI GGCC 1 cut(s) 198
Bsp119I TTCGAA 1 cut(s) 61
Bsp143I GATC 2 cut(s) 123, 181
BspACI CCGC 1 cut(s) 12
BspANI GGCC 1 cut(s) 198
BspT104I TTCGAA 1 cut(s) 61
BsrI ACTGG 1 cut(s) 199
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 2 cut(s) 123, 181
BstBI TTCGAA 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 52
BstKTI GATC 2 cut(s) 126, 184
BstMBI GATC 2 cut(s) 123, 181
BstV1I GCAGC 1 cut(s) 85
BsuRI GGCC 1 cut(s) 198
CaiI CAGNNNCTG 1 cut(s) 165
CviAII CATG 1 cut(s) 149
CviJI RGCY 3 cut(s) 72, 98, 198
CviKI_1 RGCY 3 cut(s) 72, 98, 198
DdeI CTNAG 1 cut(s) 52
DpnI GATC 2 cut(s) 125, 183
DpnII GATC 2 cut(s) 123, 181
Eco32I GATATC 1 cut(s) 172
EcoRV GATATC 1 cut(s) 172
FaeI CATG 1 cut(s) 152
FaiI YATR 1 cut(s) 150
FaqI GGGAC 1 cut(s) 147
FatI CATG 1 cut(s) 148
Fnu4HI GCNGC 2 cut(s) 13, 99
Fsp4HI GCNGC 2 cut(s) 13, 99
GluI GCNGC 2 cut(s) 13, 99
HaeIII GGCC 1 cut(s) 198
Hin1II CATG 1 cut(s) 152
Hpy188I TCNGA 2 cut(s) 31, 137
Hpy188III TCNNGA 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 36, 188
HpyCH4V TGCA 2 cut(s) 38, 78
HpyF3I CTNAG 1 cut(s) 52
Hsp92II CATG 1 cut(s) 152
Kzo9I GATC 2 cut(s) 123, 181
LpnPI CCDG 1 cut(s) 178
Lsp1109I GCAGC 1 cut(s) 85
MaeIII GTNAC 1 cut(s) 106
MalI GATC 2 cut(s) 125, 183
MboI GATC 2 cut(s) 123, 181
MluCI AATT 5 cut(s) 5, 63, 91, 113, 175
MnlI CCTC 2 cut(s) 25, 113
MseI TTAA 1 cut(s) 47
NdeII GATC 2 cut(s) 123, 181
NlaIII CATG 1 cut(s) 152
NmeAIII GCCGAG 1 cut(s) 178
NspV TTCGAA 1 cut(s) 61
PkrI GCNGC 2 cut(s) 14, 100
PstNI CAGNNNCTG 1 cut(s) 165
SaqAI TTAA 1 cut(s) 47
SatI GCNGC 2 cut(s) 13, 99
Sau3AI GATC 2 cut(s) 123, 181
SetI ASST 2 cut(s) 36, 87
SfuI TTCGAA 1 cut(s) 61
SgeI CNNG 6 cut(s) 43, 116, 139, 161, 166, 177
Sse9I AATT 5 cut(s) 5, 63, 91, 113, 175
SsiI CCGC 1 cut(s) 12
SspI AATATT 1 cut(s) 42
TaqI TCGA 2 cut(s) 61, 128
TasI AATT 5 cut(s) 5, 63, 91, 113, 175
TauI GCSGC 1 cut(s) 15
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TseI GCWGC 1 cut(s) 98
XapI RAATTY 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.