Rorug04G0158300

Cytochrome p450

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0000354
Physical Location & Seq
Reverse (-)
27631318 .. 27631876
559 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0158300.1

Sequence Viewer

Length: 264 bp
ATGTTAGATTATGATCGAGCTTTGGAGTTGTTTAGCTTGAATGCATTCAAAAGAAATGGACCTCCAGGCGATTATCTGGAACTTGCACAACATGTTGTTTGCTATGCTCAGGGCCTTCCATTAGCTTCGAGAGTTTTAGGCTCTCATACATTTCGTAGAAGCAGAGAGGAATGGGAAGCTACATTAGACAGTTGTAAAGGAGAAGATCCCCACATAGAGATAAGAAACGTTCTCAAAGTACTTGGAATAAATGAGCTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
p450

Protein Analysis

87

Amino Acids

9.91

Weight (kDa)

5.87

Isoelectric Point (pI)

55.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000354)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G13080 AT1G13080 AT1G13090 AT1G13090 AT1G13100 AT1G13110 AT2G02580 AT2G24180 AT3G26150 AT3G26160 AT3G26170 AT3G26180 AT3G26180 AT3G26190 AT3G26200 AT3G26210 AT3G26290 AT3G26290 AT3G26300 AT3G26310 AT3G26320 AT3G26330 AT3G26830 AT3G44250 AT3G53280 AT3G53290 AT3G53300 AT3G53305 AT5G25120 AT5G25130 AT5G25140 AT5G25180 AT5G35715 AT5G57260
fragaria_vesca FvH4_4g25390 FvH4_4g25390 FvH4_4g25390
malus_domestica MD13G1103500.v1.1 MD13G1103800.v1.1 MD13G1104100.v1.1 MD16G1103600.v1.1 MD16G1104000.v1.1 MD16G1104200.v1.1 MD16G1104300.v1.1
prunus_persica Prupe.1G170800_v2.0.a1 Prupe.1G242300_v2.0.a1 Prupe.1G242400_v2.0.a1
pyrus_communis pycom13g09040 pycom16g08850 pycom16g08860
rosa_chinensis RchiOBHm_Chr4g0419321 RchiOBHm_Chr4g0419411 RchiOBHm_Chr4g0419461 RchiOBHm_Chr4g0419481 RchiOBHm_Chr4g0419491 RchiOBHm_Chr4g0419571 RchiOBHm_Chr4g0432681 RchiOBHm_Chr4g0432701 RchiOBHm_Chr5g0025811
rosa_laevigata RLG00000003494 RLG00000006819 RLG00000006820 RLG00000006821 RLG00000006823 RLG00000007814 RLG00000007815 RLG00000032878
rosa_multiflora Rmu_co8315439.1_g000001 Rmu_sc0000455.1_g000013 Rmu_sc0000455.1_g000035 Rmu_sc0000455.1_g000058 Rmu_sc0000675.1_g000043 Rmu_sc0001912.1_g000035 Rmu_sc0002401.1_g000014 Rmu_sc0004932.1_g000013 Rmu_sc0008245.1_g000007 Rmu_sc0009481.1_g000005 Rmu_ssc0000467.1_g000029
rosa_roxburghii Rroxscaffold_1G00053390 Rroxscaffold_1G00054350 Rroxscaffold_4G00324380 Rroxscaffold_5G00362300 Rroxscaffold_5G00362360 Rroxscaffold_5G00374140 Rroxscaffold_5G00374160
rosa_rugosa Rorug04G0158300 Rorug04G0261600 Rorug04G0261700 Rorug04G0261800
rosa_samantha Rh4AG220300 Rh4AG316100 Rh4BG221600 Rh4BG222000 Rh4BG222100 Rh4BG222200 Rh4BG324100 Rh4CG233000 Rh4CG233100 Rh4CG233200 Rh4CG233900 Rh4CG339100 Rh4DG319500
rosa_wichuraiana Rw4G018840 Rw4G018880 Rw4G018900 Rw4G018930 Rw4G027500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 228
AclWI GGATC 1 cut(s) 200
AfaI GTAC 1 cut(s) 240
AflIII ACRYGT 1 cut(s) 91
AgsI TTSAA 2 cut(s) 40, 49
AjnI CCWGG 1 cut(s) 64
AluBI AGCT 5 cut(s) 20, 36, 125, 179, 256
AluI AGCT 5 cut(s) 20, 36, 125, 179, 256
AlwI GGATC 1 cut(s) 200
AoxI GGCC 1 cut(s) 112
Asp700I GAANNNNTTC 1 cut(s) 44
AspS9I GGNCC 2 cut(s) 59, 112
AvaII GGWCC 1 cut(s) 59
BciT130I CCWGG 1 cut(s) 66
BmcAI AGTACT 1 cut(s) 240
Bme1390I CCNGG 1 cut(s) 66
Bme18I GGWCC 1 cut(s) 59
BmgT120I GGNCC 2 cut(s) 59, 112
BmrFI CCNGG 1 cut(s) 66
BpmI CTGGAG 1 cut(s) 48
Bpu10I CCTNAGC 1 cut(s) 108
BsaBI GATNNNNATC 1 cut(s) 12
Bse8I GATNNNNATC 1 cut(s) 12
BseBI CCWGG 1 cut(s) 66
BseJI GATNNNNATC 1 cut(s) 12
BseMII CTCAG 1 cut(s) 122
BshFI GGCC 1 cut(s) 114
BsmI GAATGC 2 cut(s) 44, 46
BsnI GGCC 1 cut(s) 114
Bsp143I GATC 2 cut(s) 13, 205
BspANI GGCC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 121
BspPI GGATC 1 cut(s) 200
BssMI GATC 2 cut(s) 13, 205
Bst2UI CCWGG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 191
BstDEI CTNAG 1 cut(s) 108
BstKTI GATC 2 cut(s) 16, 208
BstMBI GATC 2 cut(s) 13, 205
BstNI CCWGG 1 cut(s) 66
BstNSI RCATGY 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 64
BstX2I RGATCY 1 cut(s) 205
BstYI RGATCY 1 cut(s) 205
BsuRI GGCC 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 59, 112
Csp6I GTAC 1 cut(s) 239
CviAII CATG 1 cut(s) 92
CviJI RGCY 7 cut(s) 20, 36, 114, 125, 141, 179, 256
CviKI_1 RGCY 7 cut(s) 20, 36, 114, 125, 141, 179, 256
CviQI GTAC 1 cut(s) 239
DdeI CTNAG 1 cut(s) 108
DpnI GATC 2 cut(s) 15, 207
DpnII GATC 2 cut(s) 13, 205
Eco47I GGWCC 1 cut(s) 59
EcoO109I RGGNCCY 1 cut(s) 112
EcoRII CCWGG 1 cut(s) 64
EcoT22I ATGCAT 1 cut(s) 46
FaeI CATG 1 cut(s) 95
FaiI YATR 5 cut(s) 12, 93, 105, 147, 215
FatI CATG 1 cut(s) 91
GsuI CTGGAG 1 cut(s) 48
HaeIII GGCC 1 cut(s) 114
Hin1II CATG 1 cut(s) 95
Hpy188III TCNNGA 2 cut(s) 77, 129
HpyAV CCTTC 1 cut(s) 125
HpyCH4III ACNGT 1 cut(s) 191
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 2 cut(s) 44, 86
HpyF3I CTNAG 1 cut(s) 108
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 1 cut(s) 95
Kzo9I GATC 2 cut(s) 13, 205
LpnPI CCDG 4 cut(s) 51, 62, 78, 95
MaeII ACGT 1 cut(s) 228
MalI GATC 2 cut(s) 15, 207
MboI GATC 2 cut(s) 13, 205
MboII GAAGA 1 cut(s) 215
MflI RGATCY 1 cut(s) 205
MnlI CCTC 2 cut(s) 72, 160
Mph1103I ATGCAT 1 cut(s) 46
MroXI GAANNNNTTC 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 66
Mva1269I GAATGC 2 cut(s) 44, 46
MvaI CCWGG 1 cut(s) 66
NdeII GATC 2 cut(s) 13, 205
NlaIII CATG 1 cut(s) 95
NsiI ATGCAT 1 cut(s) 46
NspI RCATGY 1 cut(s) 95
PciI ACATGT 1 cut(s) 91
PctI GAATGC 2 cut(s) 44, 46
PdmI GAANNNNTTC 1 cut(s) 44
PscI ACATGT 1 cut(s) 91
Psp1406I AACGTT 1 cut(s) 228
Psp6I CCWGG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 64
PspPI GGNCC 2 cut(s) 59, 112
PsuI RGATCY 1 cut(s) 205
RsaI GTAC 1 cut(s) 240
RsaNI GTAC 1 cut(s) 239
Sau3AI GATC 2 cut(s) 13, 205
Sau96I GGNCC 2 cut(s) 59, 112
ScaI AGTACT 1 cut(s) 240
ScrFI CCNGG 1 cut(s) 66
SetI ASST 7 cut(s) 22, 38, 64, 127, 181, 231, 258
SinI GGWCC 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 64
TaaI ACNGT 1 cut(s) 191
TaiI ACGT 1 cut(s) 231
TaqI TCGA 2 cut(s) 16, 128
TatI WGTACW 1 cut(s) 238
VpaK11BI GGWCC 1 cut(s) 59
XceI RCATGY 1 cut(s) 95
XmnI GAANNNNTTC 1 cut(s) 44
ZrmI AGTACT 1 cut(s) 240
Zsp2I ATGCAT 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.