Rh7BG258000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
23489317 .. 23489749
433 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG258000.1

Sequence Viewer

Length: 210 bp
ATGAAGGGTATGTTGAAGATGATACTGCAGCAGATCAATGATCCTGAAATGAAGGGCCTAGTGAAGAAGTTACTGGAGCAGAATCCAGGGGATTCAATAGAGACCTCAAGTTCCGCTTCAGGAAGTAATACAGAAAGAGAAGGGAATAACGAGACACAAGTGGAATCACTAGGACTATTAGAGGCAGCATTTCGGGTTCTATACATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.6

Weight (kDa)

4.76

Isoelectric Point (pI)

46.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000688)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 114
AclWI GGATC 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 102
AflIII ACRYGT 1 cut(s) 204
AgsI TTSAA 2 cut(s) 16, 96
AjnI CCWGG 1 cut(s) 85
Alw26I GTCTC 2 cut(s) 95, 146
AlwI GGATC 1 cut(s) 35
AoxI GGCC 1 cut(s) 55
ApeKI GCWGC 2 cut(s) 28, 185
AspS9I GGNCC 1 cut(s) 55
BbvI GCAGC 2 cut(s) 40, 197
BciT130I CCWGG 1 cut(s) 87
BcoDI GTCTC 2 cut(s) 95, 146
BfaI CTAG 2 cut(s) 59, 170
BfmI CTRYAG 1 cut(s) 26
BisI GCNGC 2 cut(s) 29, 186
BlsI GCNGC 2 cut(s) 30, 187
Bme1390I CCNGG 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 55
BmrFI CCNGG 1 cut(s) 87
BpmI CTGGAG 1 cut(s) 95
BpuEI CTTGAG 1 cut(s) 91
BsaI GGTCTC 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 86
Bse1I ACTGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 78
BseXI GCAGC 2 cut(s) 40, 197
BshFI GGCC 1 cut(s) 57
BsmAI GTCTC 2 cut(s) 95, 146
BsnI GGCC 1 cut(s) 57
Bso31I GGTCTC 1 cut(s) 95
Bsp143I GATC 2 cut(s) 33, 40
BspACI CCGC 1 cut(s) 114
BspANI GGCC 1 cut(s) 57
BspMAI CTGCAG 1 cut(s) 30
BspPI GGATC 1 cut(s) 35
BspTNI GGTCTC 1 cut(s) 95
BsrI ACTGG 1 cut(s) 78
BssECI CCNNGG 1 cut(s) 86
BssMI GATC 2 cut(s) 33, 40
Bst2UI CCWGG 1 cut(s) 87
BstKTI GATC 2 cut(s) 36, 43
BstMAI GTCTC 2 cut(s) 95, 146
BstMBI GATC 2 cut(s) 33, 40
BstNI CCWGG 1 cut(s) 87
BstNSI RCATGY 1 cut(s) 208
BstSCI CCNGG 1 cut(s) 85
BstSFI CTRYAG 1 cut(s) 26
BstV1I GCAGC 2 cut(s) 40, 197
BsuRI GGCC 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 55
CviAII CATG 1 cut(s) 205
CviJI RGCY 1 cut(s) 57
CviKI_1 RGCY 1 cut(s) 57
DpnI GATC 2 cut(s) 35, 42
DpnII GATC 2 cut(s) 33, 40
Eco31I GGTCTC 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 102
EcoO109I RGGNCCY 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 85
FaeI CATG 1 cut(s) 208
FaiI YATR 3 cut(s) 11, 202, 206
FalI AAGNNNNNCTT 2 cut(s) 100, 132
FatI CATG 1 cut(s) 204
Fnu4HI GCNGC 2 cut(s) 29, 186
Fsp4HI GCNGC 2 cut(s) 29, 186
FspBI CTAG 2 cut(s) 59, 170
GluI GCNGC 2 cut(s) 29, 186
GsuI CTGGAG 1 cut(s) 95
HaeIII GGCC 1 cut(s) 57
Hin1II CATG 1 cut(s) 208
HinfI GANTC 3 cut(s) 82, 92, 164
Hpy188III TCNNGA 2 cut(s) 44, 120
HpyAV CCTTC 2 cut(s) 46, 134
HpyCH4V TGCA 1 cut(s) 28
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 2 cut(s) 33, 40
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 5 cut(s) 57, 59, 72, 99, 105
Lsp1109I GCAGC 2 cut(s) 40, 197
MaeI CTAG 2 cut(s) 59, 170
MaeIII GTNAC 1 cut(s) 69
MalI GATC 2 cut(s) 35, 42
MboI GATC 2 cut(s) 33, 40
MboII GAAGA 2 cut(s) 28, 76
MnlI CCTC 2 cut(s) 115, 175
MspR9I CCNGG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 87
NdeII GATC 2 cut(s) 33, 40
NlaIII CATG 1 cut(s) 208
NspI RCATGY 1 cut(s) 208
PciI ACATGT 1 cut(s) 204
PfeI GAWTC 3 cut(s) 82, 92, 164
PkrI GCNGC 2 cut(s) 30, 187
PscI ACATGT 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 85
PspGI CCWGG 1 cut(s) 85
PspPI GGNCC 1 cut(s) 55
PstI CTGCAG 1 cut(s) 30
SatI GCNGC 2 cut(s) 29, 186
Sau3AI GATC 2 cut(s) 33, 40
Sau96I GGNCC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 87
SetI ASST 1 cut(s) 107
SfcI CTRYAG 1 cut(s) 26
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
SsiI CCGC 1 cut(s) 114
SspMI CTAG 2 cut(s) 59, 170
StyD4I CCNGG 1 cut(s) 85
TfiI GAWTC 3 cut(s) 82, 92, 164
TseI GCWGC 2 cut(s) 28, 185
TspDTI ATGAA 2 cut(s) 17, 65
XceI RCATGY 1 cut(s) 208
XspI CTAG 2 cut(s) 59, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.