Rw5G045350

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
79283626 .. 79284192
567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G045350.1

Sequence Viewer

Length: 567 bp
ATGATAATATACCAGATTTTACAAGCAGTTAATATTTGTTCATTTGGATCAGCTTCCTATCCAAATAGACGTAAATTTCAAGGTGCTAAACTTTGTGGCCTCAATCTTTCATGTCAAGCAAATTTCACAAGCAGTGATTTTAGGAGTGCATGTCTAAGAAATGTGTCATTCTCACATTCAAATCTTATGAGTTCAAAGTTCGACATAGCTGATGCTGAGGGTGCTGACTTCCGCATTGCAAGATTAGTATTTTGTTCATTTACTGGGGCGAATCTCCGTAGAGCTTTGTTTTCTGGTGCAGACTTGATGTATGCAACCTTAAACAATGCTGATCTTAGAAATACCAATTTGGAAGGAGCCAACTTGAGGCATGCAACCTTGAACAATGCTGATCTTAAAAATGCCAATTTGGAGGGAGCCAACTTGAGTTATGCAACCTTAAACAATGCTGATCTTACAAAGGCCAATATGAAGGGAGCAAACTTGTTTCAAGCTAAGTTGAAAGGTGTCAAGTTGAGCAAGACTAATTTGAAGTATTCAGATCTTCGAGGTGCTTATCGCTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

188

Amino Acids

20.59

Weight (kDa)

9.63

Isoelectric Point (pI)

29.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pentapeptide_4 PF13599 40 - 117 4.2e-08 Pentapeptide repeat region
Pentapeptide PF00805 80 - 119 8.1e-11 Pentapeptide repeats (8 copies)
Pentapeptide_4 PF13599 106 - 181 1.2e-11 Pentapeptide repeat region
Pentapeptide PF00805 120 - 159 1.9e-12 Pentapeptide repeats (8 copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 232
AclWI GGATC 1 cut(s) 55
AcsI RAATTY 2 cut(s) 74, 121
AfiI CCNNNNNNNGG 1 cut(s) 366
AgsI TTSAA 7 cut(s) 80, 180, 195, 382, 491, 502, 532
AluBI AGCT 4 cut(s) 53, 209, 284, 494
AluI AGCT 4 cut(s) 53, 209, 284, 494
AlwI GGATC 1 cut(s) 55
AoxI GGCC 2 cut(s) 97, 462
ApeKI GCWGC 1 cut(s) 561
ApoI RAATTY 2 cut(s) 74, 121
BbvCI CCTCAGC 1 cut(s) 216
BbvI GCAGC 1 cut(s) 548
BglII AGATCT 1 cut(s) 541
BisI GCNGC 1 cut(s) 562
BlsI GCNGC 1 cut(s) 563
BmiI GGNNCC 2 cut(s) 358, 418
BmrI ACTGGG 1 cut(s) 273
BmsI GCATC 1 cut(s) 202
BmuI ACTGGG 1 cut(s) 273
Bpu10I CCTNAGC 1 cut(s) 216
BpuEI CTTGAG 2 cut(s) 385, 445
BsaXI ACNNNNNCTCC 2 cut(s) 136, 166
Bsc4I CCNNNNNNNGG 1 cut(s) 366
Bse1I ACTGG 1 cut(s) 268
Bse3DI GCAATG 1 cut(s) 234
BseLI CCNNNNNNNGG 1 cut(s) 366
BseMI GCAATG 1 cut(s) 234
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 268
BseXI GCAGC 1 cut(s) 548
BsgI GTGCAG 1 cut(s) 318
BshFI GGCC 2 cut(s) 99, 464
BslI CCNNNNNNNGG 1 cut(s) 366
BsnI GGCC 2 cut(s) 99, 464
Bsp143I GATC 5 cut(s) 47, 331, 391, 451, 541
BspACI CCGC 1 cut(s) 232
BspANI GGCC 2 cut(s) 99, 464
BspCNI CTCAG 1 cut(s) 208
BspLI GGNNCC 2 cut(s) 358, 418
BspPI GGATC 1 cut(s) 55
BsrDI GCAATG 1 cut(s) 234
BsrI ACTGG 1 cut(s) 268
BssMI GATC 5 cut(s) 47, 331, 391, 451, 541
BstC8I GCNNGC 1 cut(s) 372
BstDEI CTNAG 4 cut(s) 155, 216, 335, 495
BstKTI GATC 5 cut(s) 50, 334, 394, 454, 544
BstMBI GATC 5 cut(s) 47, 331, 391, 451, 541
BstMWI GCNNNNNNNGC 1 cut(s) 221
BstNSI RCATGY 2 cut(s) 153, 374
BstV1I GCAGC 1 cut(s) 548
BstX2I RGATCY 1 cut(s) 541
BstYI RGATCY 1 cut(s) 541
BsuRI GGCC 2 cut(s) 99, 464
BtsI GCAGTG 1 cut(s) 139
BtsIMutI CAGTG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 372
CviAII CATG 3 cut(s) 111, 150, 371
CviJI RGCY 8 cut(s) 53, 99, 209, 284, 359, 419, 464, 494
CviKI_1 RGCY 8 cut(s) 53, 99, 209, 284, 359, 419, 464, 494
DdeI CTNAG 4 cut(s) 155, 216, 335, 495
DpnI GATC 5 cut(s) 49, 333, 393, 453, 543
DpnII GATC 5 cut(s) 47, 331, 391, 451, 541
FaeI CATG 3 cut(s) 114, 153, 374
FaiI YATR 9 cut(s) 10, 112, 151, 188, 206, 312, 372, 432, 470
FatI CATG 3 cut(s) 110, 149, 370
Fnu4HI GCNGC 1 cut(s) 562
Fsp4HI GCNGC 1 cut(s) 562
GluI GCNGC 1 cut(s) 562
HaeIII GGCC 2 cut(s) 99, 464
Hin1II CATG 3 cut(s) 114, 153, 374
HinfI GANTC 1 cut(s) 271
Hpy188I TCNGA 1 cut(s) 541
HpyAV CCTTC 2 cut(s) 347, 466
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 6 cut(s) 149, 239, 299, 314, 374, 434
HpyF10VI GCNNNNNNNGC 1 cut(s) 221
HpyF3I CTNAG 4 cut(s) 155, 216, 335, 495
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 3 cut(s) 114, 153, 374
Kzo9I GATC 5 cut(s) 47, 331, 391, 451, 541
LmnI GCTCC 3 cut(s) 356, 416, 476
LpnPI CCDG 3 cut(s) 26, 249, 279
Lsp1109I GCAGC 1 cut(s) 548
LweI GCATC 1 cut(s) 202
MaeII ACGT 1 cut(s) 70
MalI GATC 5 cut(s) 49, 333, 393, 453, 543
MboI GATC 5 cut(s) 47, 331, 391, 451, 541
MboII GAAGA 1 cut(s) 536
MflI RGATCY 1 cut(s) 541
MluCI AATT 5 cut(s) 74, 121, 346, 406, 526
MnlI CCTC 5 cut(s) 110, 211, 360, 406, 542
MseI TTAA 4 cut(s) 30, 320, 396, 440
MwoI GCNNNNNNNGC 1 cut(s) 221
NdeII GATC 5 cut(s) 47, 331, 391, 451, 541
NlaIII CATG 3 cut(s) 114, 153, 374
NlaIV GGNNCC 2 cut(s) 358, 418
NspI RCATGY 2 cut(s) 153, 374
PaeI GCATGC 1 cut(s) 374
PfeI GAWTC 1 cut(s) 271
PkrI GCNGC 1 cut(s) 563
PspN4I GGNNCC 2 cut(s) 358, 418
PsuI RGATCY 1 cut(s) 541
SaqAI TTAA 4 cut(s) 30, 320, 396, 440
SatI GCNGC 1 cut(s) 562
Sau3AI GATC 5 cut(s) 47, 331, 391, 451, 541
SfaNI GCATC 1 cut(s) 202
SmlI CTYRAG 2 cut(s) 364, 424
SmoI CTYRAG 2 cut(s) 364, 424
SphI GCATGC 1 cut(s) 374
Sse9I AATT 5 cut(s) 74, 121, 346, 406, 526
SsiI CCGC 1 cut(s) 232
SspI AATATT 1 cut(s) 34
TaiI ACGT 1 cut(s) 73
TaqI TCGA 2 cut(s) 201, 547
TasI AATT 5 cut(s) 74, 121, 346, 406, 526
TfiI GAWTC 1 cut(s) 271
Tru1I TTAA 4 cut(s) 30, 320, 396, 440
Tru9I TTAA 4 cut(s) 30, 320, 396, 440
TscAI CASTG 1 cut(s) 139
TseI GCWGC 1 cut(s) 561
TspDTI ATGAA 4 cut(s) 30, 99, 246, 485
TspGWI ACGGA 1 cut(s) 266
TspRI CASTG 1 cut(s) 139
XapI RAATTY 2 cut(s) 74, 121
XceI RCATGY 2 cut(s) 153, 374
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.