MD09G1102400.v1.1

U5 snRNA binding

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
7483515 .. 7483700
186 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1102400.v1.1.491

Sequence Viewer

Length: 186 bp
ATGTGGATTATGATGAGGAGGGAGAAGCGGGATCGGAGGAATTTAAAGCGGATGCGGTTTTCGCCGTTCGATGATGAGAAGCCTCCATTGGATTATGGTGATAATCTGTTGGATATGTTGTGCTTTGGCCTGTTATCTCACCAACTTATAAACCCACAGATGAACAATTTAAAATATAAGAAATAA

Protein Analysis

62

Amino Acids

7.56

Weight (kDa)

9.8

Isoelectric Point (pI)

49.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PRO8NT PF08082 1 - 40 5.7e-17 PRO8NT (NUC069), PrP8 N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 149
AciI CCGC 3 cut(s) 28, 49, 55
AclWI GGATC 1 cut(s) 39
AcsI RAATTY 1 cut(s) 40
AjuI GAANNNNNNNTTGG 2 cut(s) 71, 103
AlwI GGATC 1 cut(s) 39
AoxI GGCC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 40
AsuHPI GGTGA 2 cut(s) 110, 131
BceAI ACGGC 1 cut(s) 49
BmsI GCATC 1 cut(s) 42
BseGI GGATG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 31
BshFI GGCC 1 cut(s) 129
BsnI GGCC 1 cut(s) 129
Bsp143I GATC 1 cut(s) 31
BspACI CCGC 3 cut(s) 28, 49, 55
BspANI GGCC 1 cut(s) 129
BspPI GGATC 1 cut(s) 39
BssMI GATC 1 cut(s) 31
BstF5I GGATG 1 cut(s) 57
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstMWI GCNNNNNNNGC 1 cut(s) 61
BsuRI GGCC 1 cut(s) 129
BtsCI GGATG 1 cut(s) 57
CviJI RGCY 2 cut(s) 82, 129
CviKI_1 RGCY 2 cut(s) 82, 129
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
DraI TTTAAA 2 cut(s) 45, 171
FaiI YATR 5 cut(s) 11, 96, 116, 149, 177
FauI CCCGC 1 cut(s) 21
FokI GGATG 1 cut(s) 64
HaeIII GGCC 1 cut(s) 129
HphI GGTGA 2 cut(s) 110, 131
Hpy188I TCNGA 1 cut(s) 36
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 143
LweI GCATC 1 cut(s) 42
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MluCI AATT 2 cut(s) 40, 166
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 4 cut(s) 9, 12, 30, 93
MseI TTAA 2 cut(s) 44, 170
MwoI GCNNNNNNNGC 1 cut(s) 61
NdeII GATC 1 cut(s) 31
PsiI TTATAA 1 cut(s) 149
SaqAI TTAA 2 cut(s) 44, 170
Sau3AI GATC 1 cut(s) 31
SfaNI GCATC 1 cut(s) 42
SgeI CNNG 2 cut(s) 41, 142
Sse9I AATT 2 cut(s) 40, 166
SsiI CCGC 3 cut(s) 28, 49, 55
TaqI TCGA 1 cut(s) 69
TasI AATT 2 cut(s) 40, 166
Tru1I TTAA 2 cut(s) 44, 170
Tru9I TTAA 2 cut(s) 44, 170
TspDTI ATGAA 1 cut(s) 176
XapI RAATTY 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.