Rh1DG068500

Remorin, C-terminal region

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
12071531 .. 12074346
2816 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG068500.1

Sequence Viewer

Length: 318 bp
ATGACTATACTTACAGACGTTGGTGGTGGTGGGGGAATTTCACCTGGGAAGTTGAGGACTATGCTACTTGGGGTGGAGAAGAAGAGGAAGGAGCTGGAAGATTTTGAATCTAATTTCAATTTGAGATCTCAAGCTTCTGAATTTGAACGGACTGACTGCTCCAAGGAGCATCTTACATCAGTTCTTAATCTTAAAGATGAGATATCCATTGCTACTGCTGGAGCTGTGGACAGATACAAGTTAAATCGGAGCTGTGGACAGGCTTCGATTCTTGTCTATACTAAAGGAAAATTGGGAGGATCATTGCTGAATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.41

Weight (kDa)

7.76

Isoelectric Point (pI)

35.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 307
AcsI RAATTY 2 cut(s) 36, 140
AgsI TTSAA 3 cut(s) 107, 118, 146
AjnI CCWGG 1 cut(s) 43
AluBI AGCT 4 cut(s) 94, 134, 224, 252
AluI AGCT 4 cut(s) 94, 134, 224, 252
AlwI GGATC 1 cut(s) 307
ApoI RAATTY 2 cut(s) 36, 140
AsuHPI GGTGA 1 cut(s) 33
BciT130I CCWGG 1 cut(s) 45
BglII AGATCT 1 cut(s) 125
Bme1390I CCNGG 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 1 cut(s) 178
BpmI CTGGAG 1 cut(s) 240
BpuEI CTTGAG 1 cut(s) 114
BsaJI CCNNGG 2 cut(s) 44, 162
Bse3DI GCAATG 2 cut(s) 207, 302
BseBI CCWGG 1 cut(s) 45
BseDI CCNNGG 2 cut(s) 44, 162
BseMI GCAATG 2 cut(s) 207, 302
Bsp143I GATC 2 cut(s) 125, 299
BspPI GGATC 1 cut(s) 307
BsrDI GCAATG 2 cut(s) 207, 302
BssECI CCNNGG 2 cut(s) 44, 162
BssMI GATC 2 cut(s) 125, 299
BssT1I CCWWGG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 45
Bst6I CTCTTC 1 cut(s) 77
BstKTI GATC 2 cut(s) 128, 302
BstMBI GATC 2 cut(s) 125, 299
BstNI CCWGG 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 125
BstYI RGATCY 1 cut(s) 125
CviJI RGCY 5 cut(s) 94, 134, 224, 252, 263
CviKI_1 RGCY 5 cut(s) 94, 134, 224, 252, 263
DpnI GATC 2 cut(s) 127, 301
DpnII GATC 2 cut(s) 125, 299
Eam1104I CTCTTC 1 cut(s) 77
EarI CTCTTC 1 cut(s) 77
Eco130I CCWWGG 1 cut(s) 162
Eco32I GATATC 1 cut(s) 204
EcoRII CCWGG 1 cut(s) 43
EcoRV GATATC 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FaiI YATR 3 cut(s) 8, 62, 279
GsuI CTGGAG 1 cut(s) 240
HindIII AAGCTT 1 cut(s) 132
HinfI GANTC 2 cut(s) 107, 268
HphI GGTGA 1 cut(s) 33
Hpy166II GTNNAC 2 cut(s) 229, 257
Hpy188I TCNGA 2 cut(s) 139, 249
Hpy8I GTNNAC 2 cut(s) 229, 257
HpyAV CCTTC 1 cut(s) 82
HpyCH4IV ACGT 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 18
Kzo9I GATC 2 cut(s) 125, 299
LmnI GCTCC 5 cut(s) 91, 164, 166, 221, 249
LpnPI CCDG 5 cut(s) 30, 57, 80, 204, 245
LweI GCATC 1 cut(s) 178
MaeII ACGT 1 cut(s) 18
MalI GATC 2 cut(s) 127, 301
MboI GATC 2 cut(s) 125, 299
MboII GAAGA 3 cut(s) 91, 94, 110
MflI RGATCY 1 cut(s) 125
MluCI AATT 5 cut(s) 36, 112, 118, 140, 290
MnlI CCTC 3 cut(s) 48, 78, 290
MseI TTAA 3 cut(s) 186, 192, 242
MspR9I CCNGG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 45
NdeII GATC 2 cut(s) 125, 299
PfeI GAWTC 2 cut(s) 107, 268
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PsuI RGATCY 1 cut(s) 125
SaqAI TTAA 3 cut(s) 186, 192, 242
Sau3AI GATC 2 cut(s) 125, 299
ScrFI CCNGG 1 cut(s) 45
SetI ASST 6 cut(s) 21, 46, 96, 136, 226, 254
SfaNI GCATC 1 cut(s) 178
SmlI CTYRAG 1 cut(s) 129
SmoI CTYRAG 1 cut(s) 129
Sse9I AATT 5 cut(s) 36, 112, 118, 140, 290
StyD4I CCNGG 1 cut(s) 43
StyI CCWWGG 1 cut(s) 162
TaiI ACGT 1 cut(s) 21
TaqI TCGA 1 cut(s) 266
TasI AATT 5 cut(s) 36, 112, 118, 140, 290
TfiI GAWTC 2 cut(s) 107, 268
Tru1I TTAA 3 cut(s) 186, 192, 242
Tru9I TTAA 3 cut(s) 186, 192, 242
TspGWI ACGGA 1 cut(s) 163
XapI RAATTY 2 cut(s) 36, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.