MD09G1127100.v1.1

pre-mRNA-processing-splicing factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
9808509 .. 9808709
201 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1127100.v1.1.491

Sequence Viewer

Length: 201 bp
ATGAATCGAGAAGCATTTAGCAGCACAAAAGAATTGCAGAATAAGAAGACAAAGAAGAGGCCTGCCGTTGCTTTCTTACGAGTTGATGATGGACACATGAAGGTGTTTGAGAATCGTGTGAGGCAGATCCTTATGTCCCCAGGGTCCACAATATTCACAAAAATTGTCAACAAATGGAAAAGGCCCTTATCGGTCTTATGA

Protein Analysis

67

Amino Acids

7.7

Weight (kDa)

11.1

Isoelectric Point (pI)

59.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
U5_2-snRNA_bdg PF10597 33 - 62 3.1e-07 U5-snRNA binding site 2 of PrP8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 121
AjnI CCWGG 1 cut(s) 139
AlwI GGATC 1 cut(s) 121
AoxI GGCC 2 cut(s) 59, 182
ApeKI GCWGC 1 cut(s) 21
AspS9I GGNCC 2 cut(s) 144, 183
AvaII GGWCC 1 cut(s) 144
BbsI GAAGAC 1 cut(s) 53
BbvI GCAGC 1 cut(s) 33
BccI CCATC 1 cut(s) 83
BceAI ACGGC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 141
BisI GCNGC 1 cut(s) 22
BlsI GCNGC 1 cut(s) 23
Bme1390I CCNGG 1 cut(s) 141
Bme18I GGWCC 1 cut(s) 144
BmgT120I GGNCC 2 cut(s) 144, 183
BmiI GGNNCC 1 cut(s) 145
BmrFI CCNGG 1 cut(s) 141
BpiI GAAGAC 1 cut(s) 53
BsaJI CCNNGG 2 cut(s) 139, 140
BseBI CCWGG 1 cut(s) 141
BseDI CCNNGG 2 cut(s) 139, 140
BseXI GCAGC 1 cut(s) 33
BshFI GGCC 2 cut(s) 61, 184
BslFI GGGAC 1 cut(s) 121
BsmFI GGGAC 1 cut(s) 121
BsnI GGCC 2 cut(s) 61, 184
Bsp143I GATC 1 cut(s) 126
BspANI GGCC 2 cut(s) 61, 184
BspLI GGNNCC 1 cut(s) 145
BspPI GGATC 1 cut(s) 121
BssECI CCNNGG 2 cut(s) 139, 140
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 141
Bst6I CTCTTC 1 cut(s) 50
BstC8I GCNNGC 1 cut(s) 63
BstKTI GATC 1 cut(s) 129
BstMBI GATC 1 cut(s) 126
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BstV1I GCAGC 1 cut(s) 33
BstV2I GAAGAC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 126
BstYI RGATCY 1 cut(s) 126
BsuRI GGCC 2 cut(s) 61, 184
Cac8I GCNNGC 1 cut(s) 63
Cfr13I GGNCC 2 cut(s) 144, 183
CviAII CATG 1 cut(s) 97
CviJI RGCY 2 cut(s) 61, 184
CviKI_1 RGCY 2 cut(s) 61, 184
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eam1104I CTCTTC 1 cut(s) 50
EarI CTCTTC 1 cut(s) 50
Eco147I AGGCCT 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 144
EcoO109I RGGNCCY 1 cut(s) 183
EcoRII CCWGG 1 cut(s) 139
FaeI CATG 1 cut(s) 100
FaiI YATR 3 cut(s) 98, 134, 199
FaqI GGGAC 1 cut(s) 121
FatI CATG 1 cut(s) 96
Fnu4HI GCNGC 1 cut(s) 22
Fsp4HI GCNGC 1 cut(s) 22
GluI GCNGC 1 cut(s) 22
HaeIII GGCC 2 cut(s) 61, 184
Hin1II CATG 1 cut(s) 100
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HinfI GANTC 2 cut(s) 4, 112
Hpy166II GTNNAC 2 cut(s) 147, 169
Hpy188III TCNNGA 1 cut(s) 8
Hpy8I GTNNAC 2 cut(s) 147, 169
HpyAV CCTTC 1 cut(s) 94
HpyCH4V TGCA 1 cut(s) 37
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 1 cut(s) 126
LpnPI CCDG 3 cut(s) 75, 126, 153
Lsp1109I GCAGC 1 cut(s) 33
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MboII GAAGA 2 cut(s) 58, 67
MflI RGATCY 1 cut(s) 126
MluCI AATT 2 cut(s) 32, 162
MnlI CCTC 2 cut(s) 51, 114
MslI CAYNNNNRTG 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
NdeII GATC 1 cut(s) 126
NlaIII CATG 1 cut(s) 100
NlaIV GGNNCC 1 cut(s) 145
PasI CCCWGGG 1 cut(s) 140
PceI AGGCCT 1 cut(s) 61
PfeI GAWTC 2 cut(s) 4, 112
PkrI GCNGC 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 145
PspPI GGNCC 2 cut(s) 144, 183
PsuI RGATCY 1 cut(s) 126
RseI CAYNNNNRTG 1 cut(s) 101
SatI GCNGC 1 cut(s) 22
Sau3AI GATC 1 cut(s) 126
Sau96I GGNCC 2 cut(s) 144, 183
ScrFI CCNGG 1 cut(s) 141
SetI ASST 1 cut(s) 105
SgeI CNNG 7 cut(s) 20, 74, 92, 109, 128, 152, 153
SinI GGWCC 1 cut(s) 144
SmiMI CAYNNNNRTG 1 cut(s) 101
Sse9I AATT 2 cut(s) 32, 162
SseBI AGGCCT 1 cut(s) 61
SspI AATATT 1 cut(s) 153
StuI AGGCCT 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 139
TaqI TCGA 1 cut(s) 7
TaqII GACCGA 1 cut(s) 181
TasI AATT 2 cut(s) 32, 162
TfiI GAWTC 2 cut(s) 4, 112
TseI GCWGC 1 cut(s) 21
TspDTI ATGAA 2 cut(s) 17, 113
VpaK11BI GGWCC 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.