Rroxscaffold_1G00037020

Remorin, C-terminal region

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000798
Physical Location & Seq
Forward (+)
54045622 .. 54048227
2606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00037020.1

Sequence Viewer

Length: 282 bp
ATGCCGGTTTTGGTTGATGGTGGTGGGGGAATTTCACCTGGGAAGTTGAGGACTGTGCTACTTGGGGTGGAGAAGAAGAGGAAGGAGCTGGAAGATTTTGAATCTACTTTCAATTTGAGATCTCAAGCTTCTGAATTTGAACAGACTGTTAAGCTGTCAAATCTTTTGAGTCCACATCCGCCTGGTCCTGATAGAGACTGCTCCAAGGAGCACCTTACATCAGTTCTTAATCTTAAAGATGAGGTATCCATTGCTACTGCTGGAGCTGTGGACAGGGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Remorin_C

Protein Analysis

93

Amino Acids

10.03

Weight (kDa)

5.63

Isoelectric Point (pI)

42.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 179
AcsI RAATTY 2 cut(s) 30, 134
AgsI TTSAA 3 cut(s) 101, 112, 140
AjnI CCWGG 2 cut(s) 37, 181
AluBI AGCT 4 cut(s) 88, 128, 154, 266
AluI AGCT 4 cut(s) 88, 128, 154, 266
Alw21I GWGCWC 1 cut(s) 213
Alw26I GTCTC 1 cut(s) 189
AlwNI CAGNNNCTG 1 cut(s) 279
AoxI GGCC 1 cut(s) 276
ApoI RAATTY 2 cut(s) 30, 134
AspS9I GGNCC 2 cut(s) 185, 276
AsuHPI GGTGA 1 cut(s) 27
AvaII GGWCC 1 cut(s) 185
Bbv12I GWGCWC 1 cut(s) 213
BccI CCATC 1 cut(s) 11
BciT130I CCWGG 2 cut(s) 39, 183
BciVI GTATCC 1 cut(s) 256
BcoDI GTCTC 1 cut(s) 189
BfuI GTATCC 1 cut(s) 256
BglII AGATCT 1 cut(s) 119
Bme1390I CCNGG 2 cut(s) 39, 183
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 2 cut(s) 185, 276
BmrFI CCNGG 2 cut(s) 39, 183
BpmI CTGGAG 1 cut(s) 282
BpuEI CTTGAG 1 cut(s) 108
BsaJI CCNNGG 2 cut(s) 38, 204
Bse118I RCCGGY 1 cut(s) 4
Bse3DI GCAATG 1 cut(s) 249
BseBI CCWGG 2 cut(s) 39, 183
BseDI CCNNGG 2 cut(s) 38, 204
BseGI GGATG 1 cut(s) 175
BseMI GCAATG 1 cut(s) 249
BshFI GGCC 1 cut(s) 278
BsiHKAI GWGCWC 1 cut(s) 213
BsiSI CCGG 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 189
BsnI GGCC 1 cut(s) 278
Bsp1286I GDGCHC 1 cut(s) 213
Bsp143I GATC 1 cut(s) 119
BspACI CCGC 1 cut(s) 179
BspANI GGCC 1 cut(s) 278
BsrDI GCAATG 1 cut(s) 249
BsrFI RCCGGY 1 cut(s) 4
BssAI RCCGGY 1 cut(s) 4
BssECI CCNNGG 2 cut(s) 38, 204
BssMI GATC 1 cut(s) 119
BssT1I CCWWGG 1 cut(s) 204
Bst2UI CCWGG 2 cut(s) 39, 183
Bst4CI ACNGT 2 cut(s) 55, 148
Bst6I CTCTTC 1 cut(s) 71
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 189
BstMBI GATC 1 cut(s) 119
BstNI CCWGG 2 cut(s) 39, 183
BstSCI CCNGG 2 cut(s) 37, 181
BstX2I RGATCY 1 cut(s) 119
BstYI RGATCY 1 cut(s) 119
BsuI GTATCC 1 cut(s) 256
BsuRI GGCC 1 cut(s) 278
BtsCI GGATG 1 cut(s) 175
CaiI CAGNNNCTG 1 cut(s) 279
Cfr10I RCCGGY 1 cut(s) 4
Cfr13I GGNCC 2 cut(s) 185, 276
CviJI RGCY 5 cut(s) 88, 128, 154, 266, 278
CviKI_1 RGCY 5 cut(s) 88, 128, 154, 266, 278
DpnI GATC 1 cut(s) 121
DpnII GATC 1 cut(s) 119
Eam1104I CTCTTC 1 cut(s) 71
EarI CTCTTC 1 cut(s) 71
EciI GGCGGA 1 cut(s) 168
Eco130I CCWWGG 1 cut(s) 204
Eco47I GGWCC 1 cut(s) 185
EcoO109I RGGNCCY 1 cut(s) 276
EcoRII CCWGG 2 cut(s) 37, 181
EcoT14I CCWWGG 1 cut(s) 204
ErhI CCWWGG 1 cut(s) 204
FokI GGATG 1 cut(s) 162
GsuI CTGGAG 1 cut(s) 282
HaeIII GGCC 1 cut(s) 278
HapII CCGG 1 cut(s) 5
HindIII AAGCTT 1 cut(s) 126
HinfI GANTC 2 cut(s) 101, 169
HpaII CCGG 1 cut(s) 5
HphI GGTGA 1 cut(s) 27
Hpy166II GTNNAC 2 cut(s) 173, 271
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 1 cut(s) 188
Hpy8I GTNNAC 2 cut(s) 173, 271
HpyAV CCTTC 1 cut(s) 76
HpyCH4III ACNGT 2 cut(s) 55, 148
Kzo9I GATC 1 cut(s) 119
LmnI GCTCC 4 cut(s) 85, 206, 208, 263
LpnPI CCDG 9 cut(s) 18, 24, 51, 74, 168, 195, 201, 246, 259
MalI GATC 1 cut(s) 121
MboI GATC 1 cut(s) 119
MboII GAAGA 3 cut(s) 85, 88, 104
MflI RGATCY 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 213
MluCI AATT 3 cut(s) 30, 112, 134
MlyI GAGTC 1 cut(s) 178
MnlI CCTC 3 cut(s) 42, 72, 235
MseI TTAA 3 cut(s) 150, 228, 234
MspI CCGG 1 cut(s) 5
MspR9I CCNGG 2 cut(s) 39, 183
MvaI CCWGG 2 cut(s) 39, 183
NdeII GATC 1 cut(s) 119
PfeI GAWTC 1 cut(s) 101
PleI GAGTC 1 cut(s) 177
PpsI GAGTC 1 cut(s) 177
Psp6I CCWGG 2 cut(s) 37, 181
PspGI CCWGG 2 cut(s) 37, 181
PspPI GGNCC 2 cut(s) 185, 276
PstNI CAGNNNCTG 1 cut(s) 279
PsuI RGATCY 1 cut(s) 119
SaqAI TTAA 3 cut(s) 150, 228, 234
Sau3AI GATC 1 cut(s) 119
Sau96I GGNCC 2 cut(s) 185, 276
SchI GAGTC 1 cut(s) 178
ScrFI CCNGG 2 cut(s) 39, 183
SduI GDGCHC 1 cut(s) 213
SetI ASST 7 cut(s) 40, 90, 130, 156, 216, 246, 268
SinI GGWCC 1 cut(s) 185
SmlI CTYRAG 1 cut(s) 123
SmoI CTYRAG 1 cut(s) 123
Sse9I AATT 3 cut(s) 30, 112, 134
SsiI CCGC 1 cut(s) 179
StyD4I CCNGG 2 cut(s) 37, 181
StyI CCWWGG 1 cut(s) 204
TaaI ACNGT 2 cut(s) 55, 148
TasI AATT 3 cut(s) 30, 112, 134
TfiI GAWTC 1 cut(s) 101
Tru1I TTAA 3 cut(s) 150, 228, 234
Tru9I TTAA 3 cut(s) 150, 228, 234
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 2 cut(s) 30, 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.