Rmu_sc0000674.1_g000029

pre-mRNA-processing-splicing factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000674.1
Physical Location & Seq
Forward (+)
148261 .. 155271
7011 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000674.1_g000029.1.cds

Sequence Viewer

Length: 7011 bp
atgtggtacaacgccgaaatttcaccgccggggacgggaaatacctcgattccatcggcggtggctcaaccctgtcttccgtcaccggccgatcttgaagagaaagcccgcagatggcagcagctttcctccctcaagtggtccaatcgccacggcgaacggcgcgccgtcgattcgcaaaaacaggacatgcctccggagcatgtgaggaagatcgtgaaagagcacggcgacatgtcgtcgaagaagtaccggcacgacaagcgggtctacctgggagctctgaagttcgttcctcacgccgtgtacaagcttctcgagaatatgccgatgccgtgggagcaggtccgtaatgtgaaggtgctgtaccatattaccggcgcagttaccttcgtcaacgagactccctgggttgtggagccgatctacatggctcaatgggccacaatgtggatcatgatgaggagggagaagcgggatcgccggcatttcaagaggatgaggtttccgccgttcgatgatgaggagcctgtgttggattatgctgataacttgttggatgttgagcctcttgagccgattcagctcgagcttgatgccgaagaggattcggctgtgtatgactggttttatgaccataaacctcttgtgaagactaagctgatcaacggcccgacctaccggaagtggcagctctccctgccgattatggaagccctttaccggctttcaggacaggtaatttccgatttgactgatcggaactatttctatttgtttgataaggagtcgtttctgacagccaaggcattgaatatgtgtataccaggtgggccgaagttcgagccattgtttagggatatggagcaaggggaggaggattggaatgagtttaatgacataaacaagctcattattcggtctccgctgagatcagagtacaaaattgcattccctaatctttacaacaacaggccaaggaaggtaaagctctctgtttatcacacaccaatggttatgcatattaaaactgaagatcctgacctgcctgcattttattatgatccattgctaaatccaataccatgcactaacaggagtagttatgataatagtgaggaagatggtgattttgttttgcctgaaggggtggagcctcttttgagtcatactcagctttatactgacaccactgctgctgggatttccctgtattttgccccacgcccttttaacttgaggtctggtcggactcgtcgtgcagaggatatacctcttgtgtcagagtggtttaaggagcattgtcctcggtcatatcctgttaaggttcgagtcagctatcagaagttgttgaaatcgtttgtgttgaatgagctgcatcgtaggcctcccaaggcacaaaagaagaagagcttgtttcggtctcttcaggctaccaagtttttccaaactactgagcttgattgggttgaagcgggtcttcaactctgtaggcagggtcataacatgctaaatctgctgatacataggaaaggtctgaactatcttcaccttgattataattttaatctcaagcctgtgaaaaccctgacaacaaaagagcgtaagaaatctcggtttggtaatccttttcatctgttgcgtgaaatcttgcggttaacaaagcttgtagttgatgcccaggtccagttccgtttgggtaatattgatgcctttcaattggctgatggtctgcagtacatattttctcatgttggtcagttaactggaatgtaccgttacaagtataggttgatgcggcagattagaatgagcaaagatttgaagcacttgatttactaccgtttcaatactgggccggtcgggaaagggccaggatgtggattctgggcaccaatgtggagggtgtggttgtccttccttcgtggcatggtccctcttctggaacagtggttgggaaatttacttgctagacaatttgaaggacgccattctgtggcaaagacagtaactaagcagcgtgttgaaagcaatttcgacttggagtttcgagcagatgtcttgaaagatattctggatgccatgccagtgggcatgaagcaaaataaggcgaaaacaattatgcagcatctcagtgaggcatggcgttgttggaaagcaaatattccttggaaggttcctggtatgcctgctccggttgagaatataattcttcgttatgtcaagtcaaaggcaaattggtggacacatggtgctcattataaccgtgaacgaattagaagaggtgctacagtggataagacagtttgtcgaaagaatcttggaagattaactcgcctttggctaaagggagagcaggagcgacagcacaattatctcaaagatggtccatatatttcaccagaagaagtagtagcaatttactcaacaacagtgcattggttggagtcaagaaatttccaacatattccatttccccctttgttgtataagcatgataccaagctacttatccttgctctggagaggttgaaggaatcttatactgcggcagtaaaattgaaccagcatcaaagagaggagttgggtctcattgaacaagcctatgataacccccatgaggcattgatacggataaaacgtcacttgatctcacagcgtgccttcaaagacgtgagcatagagttcatggatctgtacagccatcatattccagtttttgagattgaccctcttgagaagattacagatgcatatcttgatcaatatctatggtatgaggctgacaaacgtcagctcttcccgaactggatcaagcctgcagactcggagccacctccacttttggtctataaatggtgtcaggggataaacaatttagagagtatatgggacacaagtgagggggagtgtgttgtgatgcttcagacaaaacttgagaggttatctgagaagattgacttgacattgctaaataggcttctacgtcttgttcttgaccataacattgctgattatatcactgcaaaaaacaatgtggtattgtcatacaaagatatgagtcatacaaattcatatggtcttatacggggtctccagcctgcatcatttgttgtacagtattatgggcttgttttggatctaatgcttcttggattgactcgggccaatgaaattgcaggtccacagcagaagccaaatgagttcatgacttatggggccacaaaggttgagacttgccatcctatcaggctgtacgctcgatacatagacagggtgcatatcttgttccgcttcactcaggaggaggctcgggacctcatacagcgatatcttaccgagcatccagatcccaataatgaaagtatggttggatataataataagaagtgctgggcaagagatgcaaggatgaggctcctgaaacatgatgtcaatcttggaaggagtgtcttttggaatgtcaagaaccatctccctcgaagcatcacaactttggaatgggaggacagttttgtttctgtttacagcaaggataatccaaatttgcttttcagcatgtgtggatttgaagtaagaatacttcccaagataagaatgagtacgaaggaacaccaaagagatggagtttggaacttgcaaaatgaacagacaaaggaaaggactgctgttgcttttttacgtgttgaggatgaatacatgaaggcgtttgagaatcgtgtaaggcagatccttatgtcctcagggtctacaacattcacaaaagttatcaacaaatggaatactgcccttattggtcttatgacttacttccgtgaagcagttgtacatacagcggagctgttagatttactggtcaaatgtgaaaataaaattcagacccgcattaagattggattgaattcaaagatgccaagcaggttcccacctgtcattttttacacgccaaaagaaattggaggacttggcatgttatctatgggtcacatattgattccacagagtgacctcagatactctcggcagacagaaatcggtgtgacacactttaggagtggaatgagtcatgaagaagagcagctgattccaaatctttaccgttacatacaaccatgggagagtgagtttatagattcacagcgtgtttgggcagaatatgcactaaaaagacaggaagctatggaacagaatcggcgtcttacccttgaagatttggaagattcatgggataggggaataccacgcataaatacattgttccagaaggatcgacacactttagcatatgacaaagggtggagagttcgcacagattttaagcagtaccagatcttgaagcaaaatcctttctggtggacacaccaaaggcatgatggaaaattgtggaatttgaataattatagaactgatgtgatccaagctcttggaggagttgatggaatacttgagcacaccttattcaaaggaacatacttccctacttgggagggtctcttttgggagaaggcatctggatttgaggaatcgatgaagtataaaaagttgactaatgcccaaagatctggcctcaaccaaatccccaatcgtaggtttacactttggtggtcgcctaccataaatcgagccaatgtatatgtcggttttcaagtacagctggatctgacaggaatctttatgcatgggaagatcccaaccttgaagatatcgttgattcagatattccgtgcacacttgtggcagaagattcatgaaagtgttgtgatggacctttgtcaggttttggatcaggagttggatgctttggaaattgagactgtgcagaaggaaaccatacatcccaggaagagttacaaaatgaacagctcttgtgcagacattctcctcttttctgctcataaatggcaaatgtcgaaacctagtcttgtggctgagccgaaggatgagtatgataaaaaaacaaacaacaagtactggatagacgtgcagctccgttggggggattatgattctcatgatattgaacgttacacccgggcaaagtttatggactatacaactgataacatgtctatctatccttctccgatgggagtgatgattggtattgatttagcctataatgtgcattctgcatttggtaactggtttcccggatcaaaaccactgattcaacaggcaatgaacaagatcatgaagtcaaatccggctttatatgtgttgagggagcgcataaggaaaggattgcagttgtattcctcggagcctacagagccatatttgtcttcccaaaactatggggagctcttcagcaatcaaattaaatggtttgttgacgatacaaatgtgtatcgtgttacaatgcacaagacttttgacggaaatcttgttacaaaacccatcaatggtgctatcttcatgttcaatccagggactgggcagctgttcttgaaggttatccacacaagtgtgtgggcaggacagaagcgacttgggcagttggctaaatggaaaactgcagaagaagttgctgctcttgtgcgttctctacctgttgaagaacagccaaagaaaattattgtgactcgtaagggaatgctcgacccattggaggttcatttactggattttcccaacatagtcataaaaggaagtgagctacagcttccttttcaggtttgcttgaaaattgagaagttgaatgatctggtactaaaggctactgagccacagatggttctttttaatgtttacgatgattggttgaagagtgtttcatcatacactgcattctctcggctcattctgattcttcgggcactgcatgtgaacagagacaaggcaagtatgttgttgaagcctgaccgaacagtcattagtgagccacaccacatttggccttctctttctgatgagcaatggatgaaggttgagcgtgctctaacagatctcatactgtcagactatgcgaaaaagaataatgtgaatacttcagccctcacacagtctgaaattcgtgatataatacttggagcagagattactccaccttctcaacagaggcaagagatagcagagattgagaaacaggctaaaggagttagtcagctgacagcagtcaccatgaggaccacaaacgtgcatggagatgagcttatttccaccactacgagtcaatatgagcaagctgcattcaggtccaaaactgattggcgtgtgagagcaatatcagctacaaatctacatcttcgtgtcaaccatatttatgtgagttcagaagatacaaaggaaacaggctacacttacatcatgccaatgaacattttgaaaaaatttatctgtgttgctgatctgaggacacaagttgctggttacttgtatggtataagcccacctgacaaccctcagattaaggaaatttgctgcattgtgatgccaccacagcggggcacccaccagcaagttcatcttccatcagctcttcctgagcatgatttcctcaattatttggaacctctgggatggatgcacacccagccaaatgagctacctcagctttctcctcaggatctcaccactcatgctaacatgttggagaatggcaagcaatgggatagggagaaatgcattattatgacctgcgcttttactccaggttcctgctcgttaactgcgtataaacttactccttctggttatgagtggggatgttgttctaacaagaacagcagaagaaacaataatccactagatggataccttccaactcattatgagaaggtccagatgcttctcagtgatcgcttccttggtgtctacatggttcctgataattgtccatggaacttcaatttcatgggagtgaggcatgcatgtgacatgaagtatggcatcaagcttggaccacccaaggagtactatcacgaggaacaccgaccaacccatttcatggagttcagcgaactagataaggatgacccgatggagttagatcgagattatgcctacgcatag
Functional Annotation
KEGG Pathways
Metabolic & Signaling

Protein Analysis

2336

Amino Acids

273.0

Weight (kDa)

8.9

Isoelectric Point (pI)

45.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1560, 2262
AasI GACNNNNNNGTC 2 cut(s) 266, 5867
Acc36I ACCTGC 5 cut(s) 334, 1053, 3170, 3909, 6644
AccB1I GGYRCC 2 cut(s) 1891, 6446
AccB7I CCANNNNNTGG 6 cut(s) 450, 1880, 1996, 5432, 6749, 6946
AccI GTMKAC 4 cut(s) 270, 823, 3749, 6813
AccII CGCG 1 cut(s) 165
AccIII TCCGGA 1 cut(s) 196
AclI AACGTT 1 cut(s) 5023
AcoI YGGCCR 1 cut(s) 87
AcuI CTGAAG 7 cut(s) 305, 1053, 1164, 1412, 2909, 5290, 5973
AcyI GRCGYC 2 cut(s) 1987, 4195
AdeI CACNNNGTG 6 cut(s) 304, 450, 2252, 2660, 4004, 4142
AflIII ACRYGT 4 cut(s) 234, 3682, 5064, 6585
AhdI GACNNNNNGTC 2 cut(s) 238, 2307
AjiI CACGTC 2 cut(s) 2674, 4981
AjnI CCWGG 9 cut(s) 273, 407, 826, 1680, 1873, 2179, 4838, 5425, 6649
AjuI GAANNNNNNNTTGG 2 cut(s) 3354, 3386
AleI CACNNNNGTG 6 cut(s) 1897, 4600, 4732, 5463, 5465, 6134
Alw21I GWGCWC 7 cut(s) 228, 283, 2257, 4452, 4729, 5304, 5938
Alw26I GTCTC 9 cut(s) 395, 927, 1428, 2594, 3098, 3227, 4496, 4805, 5826
Alw44I GTGCAC 1 cut(s) 4725
AlwNI CAGNNNCTG 1 cut(s) 5432
Ama87I CYCGRG 5 cut(s) 317, 587, 3162, 3312, 5031
Aor13HI TCCGGA 1 cut(s) 196
ApaLI GTGCAC 1 cut(s) 4725
AscI GGCGCGCC 1 cut(s) 163
Asp700I GAANNNNTTC 1 cut(s) 767
AspLEI GCGC 5 cut(s) 165, 167, 383, 5229, 6641
AsuC2I CCSGG 4 cut(s) 30, 5032, 5033, 5151
AsuHPI GGTGA 7 cut(s) 15, 75, 1139, 1541, 2391, 6109, 6562
AvaI CYCGRG 5 cut(s) 317, 587, 3162, 3312, 5031
AxyI CCTNAGG 2 cut(s) 3742, 6561
BaeGI GKGCMC 4 cut(s) 1894, 4729, 5818, 6449
BaeI ACNNNNGTAYC 2 cut(s) 5328, 5361
BanI GGYRCC 2 cut(s) 1891, 6446
BanII GRGCYC 2 cut(s) 283, 5304
BauI CACGAG 1 cut(s) 6920
BbsI GAAGAC 4 cut(s) 68, 659, 1472, 5274
Bbv12I GWGCWC 7 cut(s) 228, 283, 2257, 4452, 4729, 5304, 5938
BbvCI CCTCAGC 1 cut(s) 6549
BceAI ACGGC 8 cut(s) 152, 169, 176, 244, 287, 319, 496, 685
BcgI CGANNNNNNTGC 4 cut(s) 578, 612, 1289, 1323
BciT130I CCWGG 9 cut(s) 275, 409, 828, 1682, 1875, 2181, 4840, 5427, 6651
BciVI GTATCC 1 cut(s) 6746
BclI TGATCA 2 cut(s) 663, 2761
BcnI CCSGG 4 cut(s) 30, 5032, 5033, 5151
BcoDI GTCTC 9 cut(s) 395, 927, 1428, 2594, 3098, 3227, 4496, 4805, 5826
BfaI CTAG 4 cut(s) 1971, 4917, 6746, 6962
BfmI CTRYAG 7 cut(s) 1489, 1733, 2289, 2820, 5265, 5514, 5657
BfuAI ACCTGC 5 cut(s) 334, 1053, 3170, 3909, 6644
BfuI GTATCC 1 cut(s) 6746
BglII AGATCT 3 cut(s) 4329, 4559, 5944
BlpI GCTNAGC 1 cut(s) 4929
BmcAI AGTACT 2 cut(s) 4970, 6914
BmeRI GACNNNNNGTC 2 cut(s) 238, 2307
BmeT110I CYCGRG 5 cut(s) 317, 587, 3162, 3312, 5031
BmgBI CACGTC 2 cut(s) 2674, 4981
BmrI ACTGGG 2 cut(s) 1863, 5442
BmuI ACTGGG 2 cut(s) 1863, 5442
BoxI GACNNNNGTC 3 cut(s) 2790, 4770, 6113
BpiI GAAGAC 4 cut(s) 68, 659, 1472, 5274
BplI GAGNNNNNCTC 2 cut(s) 1156, 1188
BpmI CTGGAG 3 cut(s) 2543, 3080, 6633
Bpu10I CCTNAGC 2 cut(s) 6483, 6549
Bpu1102I GCTNAGC 1 cut(s) 4929
BpuEI CTTGAG 7 cut(s) 119, 593, 1258, 1556, 2756, 2957, 4466
BpuMI CCSGG 4 cut(s) 30, 5032, 5033, 5151
Bsa29I ATCGAT 1 cut(s) 4526
BsaAI YACGTR 1 cut(s) 3683
BsaBI GATNNNNATC 3 cut(s) 2754, 2766, 3435
BsaHI GRCGYC 2 cut(s) 1987, 4195
BsaI GGTCTC 5 cut(s) 927, 1428, 2594, 3098, 4496
BsaWI WCCGGW 3 cut(s) 196, 681, 2194
BsaXI ACNNNNNCTCC 6 cut(s) 518, 548, 3078, 3108, 4109, 4139
Bse118I RCCGGY 6 cut(s) 85, 252, 377, 483, 723, 1858
Bse21I CCTNAGG 2 cut(s) 3742, 6561
Bse3DI GCAATG 6 cut(s) 1067, 2966, 3006, 5184, 5921, 6611
Bse8I GATNNNNATC 3 cut(s) 2754, 2766, 3435
BseAI TCCGGA 1 cut(s) 196
BseBI CCWGG 9 cut(s) 275, 409, 828, 1682, 1875, 2181, 4840, 5427, 6651
BseCI ATCGAT 1 cut(s) 4526
BseJI GATNNNNATC 3 cut(s) 2754, 2766, 3435
BseMI GCAATG 6 cut(s) 1067, 2966, 3006, 5184, 5921, 6611
BsePI GCGCGC 1 cut(s) 163
BseRI GAGGAG 8 cut(s) 478, 539, 890, 2594, 3320, 4443, 4871, 6549
BseSI GKGCMC 4 cut(s) 1894, 4729, 5818, 6449
BseX3I CGGCCG 1 cut(s) 87
BseYI CCCAGC 3 cut(s) 1199, 3393, 6531
BsgI GTGCAG 4 cut(s) 1281, 4838, 4890, 5003
Bsh1236I CGCG 1 cut(s) 165
Bsh1285I CGRYCG 2 cut(s) 90, 1863
BshNI GGYRCC 2 cut(s) 1891, 6446
BshVI ATCGAT 1 cut(s) 4526
BsiEI CGRYCG 2 cut(s) 90, 1863
BsiHKAI GWGCWC 7 cut(s) 228, 283, 2257, 4452, 4729, 5304, 5938
BsiHKCI CYCGRG 5 cut(s) 317, 587, 3162, 3312, 5031
BslFI GGGAC 5 cut(s) 46, 1919, 2906, 3329, 5443
BsmAI GTCTC 9 cut(s) 395, 927, 1428, 2594, 3098, 3227, 4496, 4805, 5826
BsmFI GGGAC 5 cut(s) 46, 1919, 2906, 3329, 5443
BsmI GAATGC 5 cut(s) 950, 5125, 5598, 5786, 6188
Bso31I GGTCTC 5 cut(s) 927, 1428, 2594, 3098, 4496
BsoBI CYCGRG 5 cut(s) 317, 587, 3162, 3312, 5031
Bsp13I TCCGGA 1 cut(s) 196
Bsp1407I TGTACA 4 cut(s) 306, 2697, 3115, 3826
Bsp1720I GCTNAGC 1 cut(s) 4929
Bsp19I CCATGG 2 cut(s) 4112, 6836
BspDI ATCGAT 1 cut(s) 4526
BspEI TCCGGA 1 cut(s) 196
BspFNI CGCG 1 cut(s) 165
BspHI TCATGA 6 cut(s) 456, 3207, 4066, 4747, 5011, 5190
BspMAI CTGCAG 3 cut(s) 1737, 2824, 5518
BspMI ACCTGC 5 cut(s) 334, 1053, 3170, 3909, 6644
BspQI GCTCTTC 5 cut(s) 1403, 2804, 4068, 5309, 6483
BspT107I GGYRCC 2 cut(s) 1891, 6446
BspTNI GGTCTC 5 cut(s) 927, 1428, 2594, 3098, 4496
BsrDI GCAATG 6 cut(s) 1067, 2966, 3006, 5184, 5921, 6611
BsrFI RCCGGY 6 cut(s) 85, 252, 377, 483, 723, 1858
BsrGI TGTACA 4 cut(s) 306, 2697, 3115, 3826
BssAI RCCGGY 6 cut(s) 85, 252, 377, 483, 723, 1858
BssHII GCGCGC 1 cut(s) 163
BssNAI GTATAC 1 cut(s) 824
BssNI GRCGYC 2 cut(s) 1987, 4195
BssSI CACGAG 1 cut(s) 6920
BssT1I CCWWGG 8 cut(s) 804, 977, 1392, 2168, 4112, 6805, 6836, 6906
Bst1107I GTATAC 1 cut(s) 824
Bst2BI CACGAG 1 cut(s) 6920
Bst2UI CCWGG 9 cut(s) 275, 409, 828, 1682, 1875, 2181, 4840, 5427, 6651
BstACI GRCGYC 2 cut(s) 1987, 4195
BstAPI GCANNNNNTGC 2 cut(s) 3404, 4157
BstAUI TGTACA 4 cut(s) 306, 2697, 3115, 3826
BstBAI YACGTR 1 cut(s) 3683
BstDSI CCRYGG 4 cut(s) 151, 335, 4112, 6836
BstENI CCTNNNNNAGG 1 cut(s) 4772
BstFNI CGCG 1 cut(s) 165
BstHHI GCGC 5 cut(s) 165, 167, 383, 5229, 6641
BstMAI GTCTC 9 cut(s) 395, 927, 1428, 2594, 3098, 3227, 4496, 4805, 5826
BstMCI CGRYCG 2 cut(s) 90, 1863
BstNI CCWGG 9 cut(s) 275, 409, 828, 1682, 1875, 2181, 4840, 5427, 6651
BstPAI GACNNNNGTC 3 cut(s) 2790, 4770, 6113
BstSFI CTRYAG 7 cut(s) 1489, 1733, 2289, 2820, 5265, 5514, 5657
BstSLI GKGCMC 4 cut(s) 1894, 4729, 5818, 6449
BstUI CGCG 1 cut(s) 165
BstV2I GAAGAC 4 cut(s) 68, 659, 1472, 5274
BstXI CCANNNNNNTGG 5 cut(s) 2089, 3623, 4424, 4562, 5294
BstZ17I GTATAC 1 cut(s) 824
BstZI CGGCCG 1 cut(s) 87
Bsu15I ATCGAT 1 cut(s) 4526
Bsu36I CCTNAGG 2 cut(s) 3742, 6561
BsuI GTATCC 1 cut(s) 6746
BsuTUI ATCGAT 1 cut(s) 4526
BtgI CCRYGG 4 cut(s) 151, 335, 4112, 6836
BtrI CACGTC 2 cut(s) 2674, 4981
BtsI GCAGTG 4 cut(s) 1191, 3021, 5781, 5816
BveI ACCTGC 5 cut(s) 334, 1053, 3170, 3909, 6644
CaiI CAGNNNCTG 1 cut(s) 5432
CciI TCATGA 6 cut(s) 456, 3207, 4066, 4747, 5011, 5190
CfoI GCGC 5 cut(s) 165, 167, 383, 5229, 6641
Cfr10I RCCGGY 6 cut(s) 85, 252, 377, 483, 723, 1858
Cfr9I CCCGGG 1 cut(s) 5031
ClaI ATCGAT 1 cut(s) 4526
CseI GACGC 2 cut(s) 1995, 4184
CsiI ACCWGGT 1 cut(s) 826
CspCI CAANNNNNGTGG 2 cut(s) 3211, 3246
DraIII CACNNNGTG 6 cut(s) 304, 450, 2252, 2660, 4004, 4142
DrdI GACNNNNNNGTC 2 cut(s) 266, 5867
DriI GACNNNNNGTC 2 cut(s) 238, 2307
DseDI GACNNNNNNGTC 2 cut(s) 266, 5867
EaeI YGGCCR 1 cut(s) 87
EagI CGGCCG 1 cut(s) 87
Eam1105I GACNNNNNGTC 2 cut(s) 238, 2307
EciI GGCGGA 1 cut(s) 498
Ecl136II GAGCTC 2 cut(s) 281, 5302
EclXI CGGCCG 1 cut(s) 87
Eco130I CCWWGG 8 cut(s) 804, 977, 1392, 2168, 4112, 6805, 6836, 6906
Eco147I AGGCCT 1 cut(s) 1387
Eco24I GRGCYC 2 cut(s) 283, 5304
Eco31I GGTCTC 5 cut(s) 927, 1428, 2594, 3098, 4496
Eco32I GATATC 2 cut(s) 3332, 4704
Eco52I CGGCCG 1 cut(s) 87
Eco53kI GAGCTC 2 cut(s) 281, 5302
Eco57I CTGAAG 7 cut(s) 305, 1053, 1164, 1412, 2909, 5290, 5973
Eco81I CCTNAGG 2 cut(s) 3742, 6561
Eco88I CYCGRG 5 cut(s) 317, 587, 3162, 3312, 5031
EcoICRI GAGCTC 2 cut(s) 281, 5302
EcoNI CCTNNNNNAGG 1 cut(s) 4772
EcoO109I RGGNCCY 1 cut(s) 3316
EcoRI GAATTC 1 cut(s) 3901
EcoRII CCWGG 9 cut(s) 273, 407, 826, 1680, 1873, 2179, 4838, 5425, 6649
EcoRV GATATC 2 cut(s) 3332, 4704
EcoT14I CCWWGG 8 cut(s) 804, 977, 1392, 2168, 4112, 6805, 6836, 6906
EcoT22I ATGCAT 5 cut(s) 1023, 2755, 4680, 6626, 6871
EcoT38I GRGCYC 2 cut(s) 283, 5304
ErhI CCWWGG 8 cut(s) 804, 977, 1392, 2168, 4112, 6805, 6836, 6906
FalI AAGNNNNNCTT 8 cut(s) 1397, 1429, 1464, 1496, 2945, 2977, 6450, 6482
FaqI GGGAC 5 cut(s) 46, 1919, 2906, 3329, 5443
FauI CCCGC 6 cut(s) 116, 258, 468, 1468, 3890, 6435
FauNDI CATATG 2 cut(s) 3076, 4285
FbaI TGATCA 2 cut(s) 663, 2761
FblI GTMKAC 4 cut(s) 270, 823, 3749, 6813
FriOI GRGCYC 2 cut(s) 283, 5304
FspBI CTAG 4 cut(s) 1971, 4917, 6746, 6962
GlaI GCGC 5 cut(s) 164, 166, 382, 5228, 6640
GsaI CCCAGC 3 cut(s) 1203, 3397, 6535
GsuI CTGGAG 3 cut(s) 2543, 3080, 6633
HgaI GACGC 2 cut(s) 1995, 4184
HhaI GCGC 5 cut(s) 165, 167, 383, 5229, 6641
Hin1I GRCGYC 2 cut(s) 1987, 4195
Hin6I GCGC 5 cut(s) 163, 165, 381, 5227, 6639
HinP1I GCGC 5 cut(s) 163, 165, 381, 5227, 6639
HincII GTYRAC 7 cut(s) 397, 1659, 1764, 4545, 5332, 6253, 6666
HindII GTYRAC 7 cut(s) 397, 1659, 1764, 4545, 5332, 6253, 6666
HindIII AAGCTT 3 cut(s) 311, 1664, 6893
HpaI GTTAAC 3 cut(s) 1659, 1764, 6666
HphI GGTGA 7 cut(s) 15, 75, 1139, 1541, 2391, 6109, 6562
Hpy99I CGWCG 3 cut(s) 173, 244, 1260
HpyCH4IV ACGT 8 cut(s) 2641, 2673, 2791, 2986, 3682, 4980, 5023, 6135
HpySE526I ACGT 8 cut(s) 2641, 2673, 2791, 2986, 3682, 4980, 5023, 6135
Hsp92I GRCGYC 2 cut(s) 1987, 4195
HspAI GCGC 5 cut(s) 163, 165, 381, 5227, 6639
Kpn2I TCCGGA 1 cut(s) 196
KroI GCCGGC 1 cut(s) 483
KroNI GCCGGC 1 cut(s) 485
Ksp22I TGATCA 2 cut(s) 663, 2761
KspAI GTTAAC 3 cut(s) 1659, 1764, 6666
LguI GCTCTTC 5 cut(s) 1403, 2804, 4068, 5309, 6483
MabI ACCWGGT 1 cut(s) 826
MaeI CTAG 4 cut(s) 1971, 4917, 6746, 6962
MaeII ACGT 8 cut(s) 2641, 2673, 2791, 2986, 3682, 4980, 5023, 6135
MfeI CAATTG 1 cut(s) 1718
Mph1103I ATGCAT 5 cut(s) 1023, 2755, 4680, 6626, 6871
MroI TCCGGA 1 cut(s) 196
MroNI GCCGGC 1 cut(s) 483
MroXI GAANNNNTTC 1 cut(s) 767
MspA1I CMGCKG 7 cut(s) 928, 3836, 4081, 4654, 5440, 6106, 6442
MunI CAATTG 1 cut(s) 1718
Mva1269I GAATGC 5 cut(s) 950, 5125, 5598, 5786, 6188
MvaI CCWGG 9 cut(s) 275, 409, 828, 1682, 1875, 2181, 4840, 5427, 6651
MvnI CGCG 1 cut(s) 165
NaeI GCCGGC 1 cut(s) 485
NciI CCSGG 4 cut(s) 30, 5032, 5033, 5151
NcoI CCATGG 2 cut(s) 4112, 6836
NdeI CATATG 2 cut(s) 3076, 4285
NgoMIV GCCGGC 1 cut(s) 483
NmeAIII GCCGAG 2 cut(s) 4000, 5773
NmuCI GTSAC 8 cut(s) 81, 2642, 3983, 4004, 4039, 5578, 6115, 6872
NsiI ATGCAT 5 cut(s) 1023, 2755, 4680, 6626, 6871
OliI CACNNNNGTG 6 cut(s) 1897, 4600, 4732, 5463, 5465, 6134
PaeI GCATGC 1 cut(s) 6869
PaeR7I CTCGAG 2 cut(s) 317, 587
PagI TCATGA 6 cut(s) 456, 3207, 4066, 4747, 5011, 5190
PalAI GGCGCGCC 1 cut(s) 163
PasI CCCWGGG 1 cut(s) 408
PauI GCGCGC 1 cut(s) 163
PceI AGGCCT 1 cut(s) 1387
PciI ACATGT 3 cut(s) 234, 5064, 6585
PciSI GCTCTTC 5 cut(s) 1403, 2804, 4068, 5309, 6483
PcsI WCGNNNNNNNCGW 3 cut(s) 1255, 2638, 6668
PctI GAATGC 5 cut(s) 950, 5125, 5598, 5786, 6188
PdiI GCCGGC 1 cut(s) 485
PdmI GAANNNNTTC 1 cut(s) 767
PflMI CCANNNNNTGG 6 cut(s) 450, 1880, 1996, 5432, 6749, 6946
PfoI TCCNGGA 1 cut(s) 5149
Ppu21I YACGTR 1 cut(s) 3683
PpuMI RGGWCCY 1 cut(s) 3316
PscI ACATGT 3 cut(s) 234, 5064, 6585
PshAI GACNNNNGTC 3 cut(s) 2790, 4770, 6113
PsiI TTATAA 2 cut(s) 1560, 2262
Psp124BI GAGCTC 2 cut(s) 283, 5304
Psp1406I AACGTT 1 cut(s) 5023
Psp5II RGGWCCY 1 cut(s) 3316
Psp6I CCWGG 9 cut(s) 273, 407, 826, 1680, 1873, 2179, 4838, 5425, 6649
PspFI CCCAGC 3 cut(s) 1199, 3393, 6531
PspGI CCWGG 9 cut(s) 273, 407, 826, 1680, 1873, 2179, 4838, 5425, 6649
PspPPI RGGWCCY 1 cut(s) 3316
PspXI VCTCGAGB 1 cut(s) 587
PstI CTGCAG 3 cut(s) 1737, 2824, 5518
PstNI CAGNNNCTG 1 cut(s) 5432
PteI GCGCGC 1 cut(s) 163
PvuII CAGCTG 4 cut(s) 4081, 4654, 5440, 6106
SacI GAGCTC 2 cut(s) 283, 5304
SapI GCTCTTC 5 cut(s) 1403, 2804, 4068, 5309, 6483
ScaI AGTACT 2 cut(s) 4970, 6914
SexAI ACCWGGT 1 cut(s) 826
SfcI CTRYAG 7 cut(s) 1489, 1733, 2289, 2820, 5265, 5514, 5657
Sfr274I CTCGAG 2 cut(s) 317, 587
SgsI GGCGCGCC 1 cut(s) 163
SlaI CTCGAG 2 cut(s) 317, 587
SmaI CCCGGG 1 cut(s) 5033
SmlI CTYRAG 9 cut(s) 134, 317, 572, 587, 1237, 1571, 2735, 2936, 4445
SmoI CTYRAG 9 cut(s) 134, 317, 572, 587, 1237, 1571, 2735, 2936, 4445
SphI GCATGC 1 cut(s) 6869
SseBI AGGCCT 1 cut(s) 1387
SspI AATATT 2 cut(s) 1705, 2164
SspMI CTAG 4 cut(s) 1971, 4917, 6746, 6962
SstI GAGCTC 2 cut(s) 283, 5304
StuI AGGCCT 1 cut(s) 1387
StyI CCWWGG 8 cut(s) 804, 977, 1392, 2168, 4112, 6805, 6836, 6906
TaiI ACGT 8 cut(s) 2644, 2676, 2794, 2989, 3685, 4983, 5026, 6138
TaqII GACCGA 4 cut(s) 909, 1299, 1410, 5877
TatI WGTACW 9 cut(s) 306, 939, 1737, 2697, 3115, 3826, 4648, 4968, 6912
TauI GCSGC 2 cut(s) 1801, 2552
TseFI GTSAC 8 cut(s) 81, 2642, 3983, 4004, 4039, 5578, 6115, 6872
Tsp45I GTSAC 8 cut(s) 81, 2642, 3983, 4004, 4039, 5578, 6115, 6872
TspGWI ACGGA 8 cut(s) 69, 338, 1682, 2647, 3803, 4712, 4979, 5391
TspMI CCCGGG 1 cut(s) 5031
Van91I CCANNNNNTGG 6 cut(s) 450, 1880, 1996, 5432, 6749, 6946
VneI GTGCAC 1 cut(s) 4725
XagI CCTNNNNNAGG 1 cut(s) 4772
XcmI CCANNNNNNNNNTGG 2 cut(s) 4370, 5889
XhoI CTCGAG 2 cut(s) 317, 587
XmaI CCCGGG 1 cut(s) 5031
XmiI GTMKAC 4 cut(s) 270, 823, 3749, 6813
XmnI GAANNNNTTC 1 cut(s) 767
XspI CTAG 4 cut(s) 1971, 4917, 6746, 6962
ZrmI AGTACT 2 cut(s) 4970, 6914
Zsp2I ATGCAT 5 cut(s) 1023, 2755, 4680, 6626, 6871
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.