Rmu_sc0006535.1_g000005

pre-mRNA-processing-splicing factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006535.1
Physical Location & Seq
Forward (+)
9869 .. 19797
9929 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006535.1_g000005.1.cds

Sequence Viewer

Length: 7131 bp
atgtggaacaacggccagattgtgccgccaggcactggtggctcgtcgattccgccaccgcccgcggctcagccctcttatacggtgttgccgcctccggcagatgccgaggccgtgctcgaagagaaggctcgtaaatggcagcaactaaattccaagcggtacagcgacaagcgcaagtttggcttcgttgagacgcagaaggaggacatgcctcctgagcatgtcaggaagatcattagagaccatggggacatgtcttcgaagaaattccgtcacgataaacgcgtgtatctaggagcacttaaatttgttccgcatgcagtttacaagcttctcgagaatatgccaatgccctgggagcaggtccgtgatgtgaaggttctgtaccatataactggggcaattacatttgtgaatgagataccttgggttgttgaacctatatatctggctcaggtccgtgatgtgaaggttctgtaccatataactggggcaattacatttgtgaatgagataccttgggttgttgaacctatatatctggctcagtggggttcaatgtggattatgatgagaagggagaagagggatcgtcgacattttaaaagaatgcggtttccaccttttgatgatgaggaacctccattagattatgctgataatctgttagatgttgatcctctagagccaattcaactggagttggatgaagacgaagattctgctgtttatacttggttttatgaccataaacctctagtcaagacaaaactcattaacggtccaagttaccggaaatggcatctctcccttccaatcatggcaactctccaccggcttgcaggacagctactatctgatttgatagaccgcaattatttctacttgtttgacatggagtctttctttacagcgaaagccctcaatatgtgcattccaggtgggcctaagtttgaacctttgtatcgggatatggagaaaggggatgaggactggaatgagtttaatgacattaacaagctgattattcggtcacctctcagaacagagtacagaattgcgttccctcatctctacaacaatagacccaggaaggtaaagctctgtgtgtatcacacacccatggttatgtacataaaaactgaggatcctgatctacctgcattttattatgatcccttgatacacccaatccccagcacaaacaaggagcgacgtgaaaagaagattgatgaggatgatgacactttcatactgccagaaggggtagaaccatttctgagtgatactcagctttatactgacacaacagcagctggagtttccctcttgtttgcaccacgcccctttaacatgagatctgggcggactcgccgtgcagaagatataccccttgtgtcagagtggtataaagagcattgtcctccgtcctatccagtgaaagtgcgggtcagctatcagaaattgttaaaatgttttgtgttgaacgagttgcatcatagaccacccaaggctcaaaagaagaagcacttgtttcgatcacttcaagctactaagttcttccaaactacagaacttgattgggctgaagcgggtcttcaagtctgcaagcagggttataacatgctaaatctcttgatccacaggaaaaatttgaattaccttcaccttgattataatttcaatctgaagcctgtgaaaaccctgacaactaaagagcgtaaaaagtcccggtttggtaatgcttttcatctttgccgtgagatcttgcggttgacaaagctggtagttgatgccaacatccagttccgtttgggtaatgtcgatgcctttcaattggctgatggcctgcagtacactttctctcatgttggccagttgactggtatgtatcgttacaaatacaggttgatgcgtcagattagaatgtgcaaagatctgaagcacttgatttactaccgtttcaacacgggaccagttgggaaagggcctggatgtggattctgggcgccgatgtggagggtttggttgttcttccttcgtggcatagttcctcttttggaacggtggttgggaaatttacttgcacggcaatttgaagggcgccattcaaaaggagtggcaaaaactgtaactaagcagcgtgtggaaagccattttgatttggagcttcgagctgctgtcatgcatgatgttcttgatgcgatgcctgagggaatcaagcaaaataaggccagaactatattgcaacatctcagtgaggcatggcgttgctggaaagcaaatattccttggaaggtacctggtttgccagttcccattgagaatatgattcttcgttatgtcaagtcaaaggcagactggtggacaaatgtggctcattacaatcgtgaacgtataagaagaggtgctacagtagataagacagtttgtcggaagaatcttggaagattaacacgcctttggctgaaggcagagcaggaacgacagcacaattatctcaaagatggcccatatgttacaccagaggaggcagttgcaatttacacgacaactgtgcattggttggagtcaagaaagttcagccccatcccatttcctccgttgtcgtacaagcatgataccaagctactcatccttgctctggagaggttgaaggaatcatatagtgttgctgtgagactgaatcagcttcaaagagaagagcttggtcttattgaacaagcctatgataacccgcatgaagcattgtcacgaattaagcgtcacttactcactcagcgtgccttcaaagaagttggcatagagttcatggatttgtacagctatctcattccagtctatgagattgaacctcttgagaagattacagatgcatatcttgatcaatatctatggtatgagggtgacaaacgtcatctcttcccgaactggatcaagcctgcagattcggagccacctccactcttggtttataaatggtgtcagggaataaacaatttacagagtatctgggacacgagtgacgggcagtgtgttgttatgcttcagaccaagtttgagaagttctttgaaaagattgacttgacaatgctaaataggcttctacgtctagttcttgatcataatatcgctgattatgtcactgcgaagaacaatgtggtattgtcctacaaggatatgagtcatacaaattcgtatggtcttattcgtggtcttcagtttgcatcctttgttgtacagtattatgggcttgtgttggatctattgcttcttggattgactcgagccagtgagattgctggaccaccccagatgccaaatgagttcatcacttattgggacacaaaggtcgagacccggcatcctatcaggctgtactctcgatacatagacagggtgcacatcttgttccgcttcactcatgaggaagctcgggatcttatccagcgatatctcactgaacatcctgatcctaataatgagaatatggtgggatataacaacaagaagtgctggccaagagatgccagaatgaggctcatgaaacacgatgtcaatcttggaaggagtgttttctgggatatgaaaaaccgtctccctcgaagcatcacaactttagagtgggagaacagctttgtttctgtttacagcaaggataatccaaatttgctcttcagcatgtgtgggtttgaggttcggatacttcccaagataagaatgagccaagaggcattcagcaacacaagagatggagtttggaatttgcagaatgaacagacaaaggaaaggactgcagttgctttcttacgtgttgatgatgaacacatgaaagtatttgagaatcgtgtgaggcagattcttatgtcgtcagggtctaccacatttacaaagattgtcaacaaatggaatacagctctgattggtcttatgacttacttccgggaagcaactgtacatacgcaagaactgttagatttactagtcaagtgcgaaaacaaaattcagacccgcattaagattggattaaattcaaagatgcctagtaggtttccacctgtcatcttttacacaccaaaagaaattggaggacttggaatgttatctatgggtcacatattgattccccaaagtgatctcagatacagtcagcagacagatgttggtgtgacacactttaggagtgggatgagtcatgaagaggaccagctgattccaaatctgtaccgttacatacaaccttgggagagtgaattcattgattcccagcgggtttgggcagaatatgctctgaaaaggcaggaggctcaagcacaaaacaggcgcctaacccttgaagatttggaagattcatgggataggggaattccacgcataaatactttgttccagaaagatcggcacactttagcatatgacaaagggtggagagttcgtactgattttaagcagtaccaggtcttgaaacaaaatcctttttggtggacacaccaaaggcatgacggaaaactttggaacttgaacaactacagaactgatgttattcaagctcttggaggtgtggagggaatcttggagcataccttatttaaaggaacatacttccctacctgggagggtctcttctgggaaaaagcatctggttttgaggaatcgatgaagtacaagaagctgactaatgcacagagatctgggctcaaccaaattcccaatcgtaggttcacgctttggtggtcgccgaccattaatcgggctaatgtatatgtcggtttccaagtgcagttagatcttactgggatctttatgcatgggaaaattccaaccttgaagatatccttgattcaaatattccgtgcacatttgtggcaaaagatccatgaaagtgttgtcatggatctctgtcaggttttggatcaggagttagatgctttggaaattgagactgtgcagaaggaaacgattcatcccaggaagagttacaaaatgaacagttcttgtgctgacattctactctttgctgcccatagatggccaatgtcaaaacctagtcttgtggcggagccaaaggatgtgtttgatcagaaagcaagcaacaagtactggatagatgtacagctccgatggggagattatgattcccacgatattgaacgttacacccgagccaagtttatggattatacaacagacaacatgtctatctatccctcccccacaggggtgatgattggtcttgatctggcgtataatttacattctgcttttggtaattggtttcctgggtccaaaccactgcttcagcaggcaatgaacaaaataatgaagtcaaatccagctttgtacgtcttgcgggagcggatacggaaaggattgcagctttactcttcagagcctacagaaccttacttgtcatcccagaactatggggagattttcagcaatcaaattatttggtttgttgatgataccaatgtgtatcgtgttacaatccacaagacatttgaaggaaatctcactacaaaaccaattaatggtgcgattttcatattcaatccaaggactgggcagctgttcctgaaggtcatccacacaagtgtatgggcaggacagaagcgtcttggtcagttggccaagtggaaaaccgcagaagaagttgctgcacttgtgcgttctttaccagttgaagagcagccaaaacaaattattgtgactcgaaagggaatgcttgatccgctggaggtgcacttgttggatttccctaacatagtcataaaaggaagtgagctgcagcttcctttccaggcttgtcttaagattgagaaatttggtgatctgatattgaaggctactgagccacagatggttcttttcaacatctatgatgattggttgaagagtatatcatcatatactgcattctctcggctcattttgattcttcgtgcacttcatgtgaacaatgagaaggcaaagatgttactgaaacctgatacaacggtcattactgagccacaccacatctggccttctctttctgatgatcaatggatgaaggttgaggttgctctaagggatctgattctctcagattatgcaaaaaagaacaacgtgaacacatcagctctgacacaatctgagattcgtgatatcattcttggagctgagattactcctccttcacagcaaaggcaacaaattgcagagattgaaaagcagcataaagaagcaagtcagctgacagcagttactactaggacgacgaatgtgcatggtgatgaactcattgtcaccactactagtccttatgagcaagctgcatttgggtccaagaccgattggcgtgtgagagcaatatcggctaccaatctctaccttcgtgtcaatcatatatatgtgaattcagaggatgtgaaggaaacgggttacacttatatcatgccaaagaacatattgaagaagttcatctgtgttgcggatctgaggacacaaattgctggttacttgtacggtgtaagcccacctgacaaccctcaggttaaggaaattcgctgcattgccatgccaccgcagtggggaacccaccagcaagttaatcttccaactgctcttcccgagcatgatttcctcaatgatctggaacctttgggatggatgcacacacaaccaaacgaacttcctcagctttctcctcaggatctaacctctcatgctaagatcttggaaagcaccaagcaatgggatggggagaagtgcattattttaacctgcagtttcactcctggttcctgctcgttaactgcatacaaactcactccatctggttatgagtggggacgggtcaacaaagacacaggaagcaatccacacggttacctcccaactcattacgagaaggtccaaatgcttctcagtgatcggttccttggtttctatatgattcctgataatggtccatggaactacaacttcatgggggtgaagcatacacaaggcatgaagtatggtatcaagcttgggacaccgagggagtactatcatgaggaccaccggccaacccattacctcgagtttagcaacatggaggagggtgacacagtggtgggagatcgtgacgatatattcacctaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling

Protein Analysis

2376

Amino Acids

277.52

Weight (kDa)

8.87

Isoelectric Point (pI)

41.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 1623, 1680, 2979
AasI GACNNNNNNGTC 2 cut(s) 3353, 5616
Acc36I ACCTGC 3 cut(s) 355, 1171, 6776
Acc65I GGTACC 1 cut(s) 2302
AccB1I GGYRCC 4 cut(s) 2011, 2106, 2302, 4326
AccB7I CCANNNNNTGG 4 cut(s) 35, 5534, 5564, 6738
AccBSI CCGCTC 1 cut(s) 5359
AccI GTMKAC 2 cut(s) 598, 3881
AccII CGCG 2 cut(s) 65, 288
AclI AACGTT 1 cut(s) 5155
AcoI YGGCCR 6 cut(s) 13, 1876, 3521, 5033, 5631, 7052
AcyI GRCGYC 3 cut(s) 2012, 2107, 4327
AflII CTTAAG 1 cut(s) 5813
AflIII ACRYGT 4 cut(s) 255, 286, 3814, 5196
AhdI GACNNNNNGTC 3 cut(s) 901, 2433, 5197
AhlI ACTAGT 2 cut(s) 3985, 6299
AjiI CACGTC 1 cut(s) 1220
AjuI GAANNNNNNNTTGG 4 cut(s) 1793, 1825, 4706, 4738
AleI CACNNNNGTG 5 cut(s) 4864, 5222, 5595, 6571, 7100
Alw21I GWGCWC 6 cut(s) 120, 304, 3408, 4861, 5748, 5950
Alw26I GTCTC 7 cut(s) 188, 237, 2677, 3353, 3605, 4628, 4937
Alw44I GTGCAC 4 cut(s) 3404, 4857, 5744, 5946
AlwNI CAGNNNCTG 2 cut(s) 35, 1319
Ama87I CYCGRG 6 cut(s) 338, 3288, 3438, 5163, 6614, 7067
ApaLI GTGCAC 4 cut(s) 3404, 4857, 5744, 5946
ArsI GACNNNNNNTTYG 2 cut(s) 2752, 2784
AseI ATTAAT 2 cut(s) 4749, 5532
Asp700I GAANNNNTTC 4 cut(s) 269, 1278, 4962, 6461
Asp718I GGTACC 1 cut(s) 2302
AspLEI GCGC 4 cut(s) 177, 2014, 2109, 4329
AsuC2I CCSGG 3 cut(s) 1735, 3364, 3947
AsuII TTCGAA 1 cut(s) 263
AvaI CYCGRG 6 cut(s) 338, 3288, 3438, 5163, 6614, 7067
AxyI CCTNAGG 3 cut(s) 2214, 6534, 6693
BaeGI GKGCMC 4 cut(s) 3408, 4861, 5748, 5950
BaeI ACNNNNGTAYC 8 cut(s) 275, 308, 950, 983, 5460, 5493, 5985, 6018
BalI TGGCCA 4 cut(s) 1878, 3523, 5035, 5633
BamHI GGATCC 1 cut(s) 1150
BanI GGYRCC 4 cut(s) 2011, 2106, 2302, 4326
BanII GRGCYC 1 cut(s) 4701
BarI GAAGNNNNNNTAC 8 cut(s) 371, 403, 464, 496, 2398, 2430, 3942, 3974
BauI CACGAG 1 cut(s) 3022
BbsI GAAGAC 4 cut(s) 252, 720, 1592, 3212
Bbv12I GWGCWC 6 cut(s) 120, 304, 3408, 4861, 5748, 5950
BbvCI CCTCAGC 1 cut(s) 6681
BceAI ACGGC 5 cut(s) 28, 98, 1362, 1746, 2108
BcgI CGANNNNNNTGC 8 cut(s) 707, 741, 1520, 1554, 2542, 2576, 6250, 6284
BciVI GTATCC 2 cut(s) 3699, 5355
BclI TGATCA 4 cut(s) 2887, 3124, 5080, 6043
BcnI CCSGG 3 cut(s) 1735, 3364, 3947
BcoDI GTCTC 7 cut(s) 188, 237, 2677, 3353, 3605, 4628, 4937
BcuI ACTAGT 2 cut(s) 3985, 6299
BfaI CTAG 9 cut(s) 296, 686, 761, 3116, 3986, 4047, 5049, 6255, 6300
BfmI CTRYAG 9 cut(s) 1572, 1853, 2415, 2946, 3798, 4531, 5397, 5789, 6769
BfoI RGCGCY 3 cut(s) 2015, 2110, 4330
BfrI CTTAAG 1 cut(s) 5813
BfuAI ACCTGC 3 cut(s) 355, 1171, 6776
BfuI GTATCC 2 cut(s) 3699, 5355
BglII AGATCT 6 cut(s) 1361, 1767, 1939, 4691, 4789, 6717
BlpI GCTNAGC 1 cut(s) 69
BmcAI AGTACT 2 cut(s) 5102, 7034
BmeRI GACNNNNNGTC 3 cut(s) 901, 2433, 5197
BmeT110I CYCGRG 6 cut(s) 338, 3288, 3438, 5163, 6614, 7067
BmgBI CACGTC 1 cut(s) 1220
BmrI ACTGGG 4 cut(s) 408, 501, 4806, 5574
BmuI ACTGGG 4 cut(s) 408, 501, 4806, 5574
BoxI GACNNNNGTC 1 cut(s) 2916
BpiI GAAGAC 4 cut(s) 252, 720, 1592, 3212
BplI GAGNNNNNCTC 4 cut(s) 1276, 1308, 1314, 1346
BpmI CTGGAG 4 cut(s) 722, 1341, 2669, 5759
Bpu10I CCTNAGC 3 cut(s) 219, 456, 6681
Bpu1102I GCTNAGC 1 cut(s) 69
Bpu14I TTCGAA 1 cut(s) 263
BpuEI CTTGAG 2 cut(s) 2882, 4296
BpuMI CCSGG 3 cut(s) 1735, 3364, 3947
Bsa29I ATCGAT 1 cut(s) 4658
BsaAI YACGTR 1 cut(s) 3815
BsaBI GATNNNNATC 5 cut(s) 678, 1155, 2880, 2892, 3561
BsaHI GRCGYC 3 cut(s) 2012, 2107, 4327
BsaI GGTCTC 3 cut(s) 237, 3353, 4628
BsaWI WCCGGW 1 cut(s) 795
BsaXI ACNNNNNCTCC 2 cut(s) 4423, 4453
Bse118I RCCGGY 2 cut(s) 837, 7050
Bse21I CCTNAGG 3 cut(s) 2214, 6534, 6693
Bse3DI GCAATG 3 cut(s) 5316, 6555, 6743
Bse8I GATNNNNATC 5 cut(s) 678, 1155, 2880, 2892, 3561
BseCI ATCGAT 1 cut(s) 4658
BseJI GATNNNNATC 5 cut(s) 678, 1155, 2880, 2892, 3561
BseMI GCAATG 3 cut(s) 5316, 6555, 6743
BseRI GAGGAG 4 cut(s) 2546, 6165, 6681, 7100
BseSI GKGCMC 4 cut(s) 3408, 4861, 5748, 5950
BseYI CCCAGC 2 cut(s) 1199, 4269
BsgI GTGCAG 4 cut(s) 1401, 4802, 4970, 5646
Bsh1236I CGCG 2 cut(s) 65, 288
BshNI GGYRCC 4 cut(s) 2011, 2106, 2302, 4326
BshVI ATCGAT 1 cut(s) 4658
BsiHKAI GWGCWC 6 cut(s) 120, 304, 3408, 4861, 5748, 5950
BsiHKCI CYCGRG 6 cut(s) 338, 3288, 3438, 5163, 6614, 7067
BsiSI CCGG 7 cut(s) 98, 796, 838, 1735, 3364, 3946, 7051
BslFI GGGAC 7 cut(s) 266, 1717, 1989, 3032, 3359, 6849, 7033
BsmAI GTCTC 7 cut(s) 188, 237, 2677, 3353, 3605, 4628, 4937
BsmBI CGTCTC 2 cut(s) 188, 3605
BsmFI GGGAC 7 cut(s) 266, 1717, 1989, 3032, 3359, 6849, 7033
BsmI GAATGC 5 cut(s) 618, 936, 3737, 5730, 5918
Bso31I GGTCTC 3 cut(s) 237, 3353, 4628
BsoBI CYCGRG 6 cut(s) 338, 3288, 3438, 5163, 6614, 7067
Bsp119I TTCGAA 1 cut(s) 263
Bsp1286I GDGCHC 7 cut(s) 120, 304, 3408, 4701, 4861, 5748, 5950
Bsp1407I TGTACA 5 cut(s) 1134, 2823, 3241, 3958, 5113
Bsp1720I GCTNAGC 1 cut(s) 69
Bsp19I CCATGG 3 cut(s) 247, 1125, 6956
BspDI ATCGAT 1 cut(s) 4658
BspFNI CGCG 2 cut(s) 65, 288
BspHI TCATGA 4 cut(s) 3427, 3546, 4198, 7039
BspMAI CTGCAG 5 cut(s) 1857, 2950, 3802, 5793, 6773
BspMI ACCTGC 3 cut(s) 355, 1171, 6776
BspQI GCTCTTC 4 cut(s) 2700, 3683, 5682, 6615
BspT104I TTCGAA 1 cut(s) 263
BspT107I GGYRCC 4 cut(s) 2011, 2106, 2302, 4326
BspTI CTTAAG 1 cut(s) 5813
BspTNI GGTCTC 3 cut(s) 237, 3353, 4628
BsrBI CCGCTC 1 cut(s) 5359
BsrDI GCAATG 3 cut(s) 5316, 6555, 6743
BsrFI RCCGGY 2 cut(s) 837, 7050
BsrGI TGTACA 5 cut(s) 1134, 2823, 3241, 3958, 5113
BssAI RCCGGY 2 cut(s) 837, 7050
BssNI GRCGYC 3 cut(s) 2012, 2107, 4327
BssSI CACGAG 1 cut(s) 3022
Bst2BI CACGAG 1 cut(s) 3022
BstACI GRCGYC 3 cut(s) 2012, 2107, 4327
BstAFI CTTAAG 1 cut(s) 5813
BstAPI GCANNNNNTGC 1 cut(s) 4289
BstAUI TGTACA 5 cut(s) 1134, 2823, 3241, 3958, 5113
BstBAI YACGTR 1 cut(s) 3815
BstBI TTCGAA 1 cut(s) 263
BstDSI CCRYGG 4 cut(s) 63, 247, 1125, 6956
BstEII GGTNACC 2 cut(s) 1035, 6872
BstFNI CGCG 2 cut(s) 65, 288
BstH2I RGCGCY 3 cut(s) 2015, 2110, 4330
BstHHI GCGC 4 cut(s) 177, 2014, 2109, 4329
BstMAI GTCTC 7 cut(s) 188, 237, 2677, 3353, 3605, 4628, 4937
BstNSI RCATGY 7 cut(s) 214, 227, 259, 323, 1630, 3688, 5200
BstPAI GACNNNNGTC 1 cut(s) 2916
BstPI GGTNACC 2 cut(s) 1035, 6872
BstSFI CTRYAG 9 cut(s) 1572, 1853, 2415, 2946, 3798, 4531, 5397, 5789, 6769
BstSLI GKGCMC 4 cut(s) 3408, 4861, 5748, 5950
BstUI CGCG 2 cut(s) 65, 288
BstV2I GAAGAC 4 cut(s) 252, 720, 1592, 3212
BstXI CCANNNNNNTGG 7 cut(s) 357, 398, 491, 1886, 5176, 5426, 6573
Bsu15I ATCGAT 1 cut(s) 4658
Bsu36I CCTNAGG 3 cut(s) 2214, 6534, 6693
BsuI GTATCC 2 cut(s) 3699, 5355
BsuTUI ATCGAT 1 cut(s) 4658
BtgI CCRYGG 4 cut(s) 63, 247, 1125, 6956
BtgZI GCGATG 1 cut(s) 2222
BtrI CACGTC 1 cut(s) 1220
BtsI GCAGTG 4 cut(s) 3041, 3147, 5294, 6578
BveI ACCTGC 3 cut(s) 355, 1171, 6776
CaiI CAGNNNCTG 2 cut(s) 35, 1319
CciI TCATGA 4 cut(s) 3427, 3546, 4198, 7039
CfoI GCGC 4 cut(s) 177, 2014, 2109, 4329
Cfr10I RCCGGY 2 cut(s) 837, 7050
Cfr42I CCGCGG 1 cut(s) 66
ClaI ATCGAT 1 cut(s) 4658
CseI GACGC 4 cut(s) 205, 1907, 2756, 5606
CsiI ACCWGGT 2 cut(s) 2305, 4458
CspCI CAANNNNNGTGG 2 cut(s) 2103, 2138
DinI GGCGCC 3 cut(s) 2013, 2108, 4328
DraI TTTAAA 2 cut(s) 607, 4594
DrdI GACNNNNNNGTC 2 cut(s) 3353, 5616
DriI GACNNNNNGTC 3 cut(s) 901, 2433, 5197
DseDI GACNNNNNNGTC 2 cut(s) 3353, 5616
EaeI YGGCCR 6 cut(s) 13, 1876, 3521, 5033, 5631, 7052
Eam1105I GACNNNNNGTC 3 cut(s) 901, 2433, 5197
EciI GGCGGA 3 cut(s) 42, 1384, 5075
Eco24I GRGCYC 1 cut(s) 4701
Eco31I GGTCTC 3 cut(s) 237, 3353, 4628
Eco32I GATATC 3 cut(s) 3458, 4836, 6151
Eco81I CCTNAGG 3 cut(s) 2214, 6534, 6693
Eco88I CYCGRG 6 cut(s) 338, 3288, 3438, 5163, 6614, 7067
Eco91I GGTNACC 2 cut(s) 1035, 6872
EcoO109I RGGNCCY 1 cut(s) 1991
EcoO65I GGTNACC 2 cut(s) 1035, 6872
EcoRI GAATTC 3 cut(s) 4256, 4368, 6400
EcoRV GATATC 3 cut(s) 3458, 4836, 6151
EcoT22I ATGCAT 3 cut(s) 2193, 2881, 4812
EcoT38I GRGCYC 1 cut(s) 4701
EgeI GGCGCC 3 cut(s) 2013, 2108, 4328
EheI GGCGCC 3 cut(s) 2013, 2108, 4328
Esp3I CGTCTC 2 cut(s) 188, 3605
FaqI GGGAC 7 cut(s) 266, 1717, 1989, 3032, 3359, 6849, 7033
FauI CCCGC 7 cut(s) 70, 1443, 1588, 2748, 4022, 4266, 5346
FauNDI CATATG 2 cut(s) 2518, 4417
FbaI TGATCA 4 cut(s) 2887, 3124, 5080, 6043
FblI GTMKAC 2 cut(s) 598, 3881
FriOI GRGCYC 1 cut(s) 4701
FspBI CTAG 9 cut(s) 296, 686, 761, 3116, 3986, 4047, 5049, 6255, 6300
GlaI GCGC 4 cut(s) 176, 2013, 2108, 4328
GsaI CCCAGC 2 cut(s) 1203, 4273
GsuI CTGGAG 4 cut(s) 722, 1341, 2669, 5759
HaeII RGCGCY 3 cut(s) 2015, 2110, 4330
HapII CCGG 7 cut(s) 98, 796, 838, 1735, 3364, 3946, 7051
HgaI GACGC 4 cut(s) 205, 1907, 2756, 5606
HhaI GCGC 4 cut(s) 177, 2014, 2109, 4329
Hin1I GRCGYC 3 cut(s) 2012, 2107, 4327
Hin6I GCGC 4 cut(s) 175, 2012, 2107, 4327
HinP1I GCGC 4 cut(s) 175, 2012, 2107, 4327
HincII GTYRAC 6 cut(s) 599, 1779, 1884, 3904, 6798, 6844
HindII GTYRAC 6 cut(s) 599, 1779, 1884, 3904, 6798, 6844
HindIII AAGCTT 2 cut(s) 332, 7013
HpaI GTTAAC 1 cut(s) 6798
HpaII CCGG 7 cut(s) 98, 796, 838, 1735, 3364, 3946, 7051
Hpy99I CGWCG 4 cut(s) 49, 600, 1221, 6265
HpyCH4IV ACGT 8 cut(s) 1219, 2398, 2917, 3112, 3814, 5155, 5346, 6111
HpySE526I ACGT 8 cut(s) 1219, 2398, 2917, 3112, 3814, 5155, 5346, 6111
Hsp92I GRCGYC 3 cut(s) 2012, 2107, 4327
HspAI GCGC 4 cut(s) 175, 2012, 2107, 4327
KasI GGCGCC 3 cut(s) 2011, 2106, 4326
KpnI GGTACC 1 cut(s) 2306
Ksp22I TGATCA 4 cut(s) 2887, 3124, 5080, 6043
KspAI GTTAAC 1 cut(s) 6798
KspI CCGCGG 1 cut(s) 66
LguI GCTCTTC 4 cut(s) 2700, 3683, 5682, 6615
MabI ACCWGGT 2 cut(s) 2305, 4458
MaeI CTAG 9 cut(s) 296, 686, 761, 3116, 3986, 4047, 5049, 6255, 6300
MaeII ACGT 8 cut(s) 1219, 2398, 2917, 3112, 3814, 5155, 5346, 6111
MbiI CCGCTC 1 cut(s) 5359
MfeI CAATTG 1 cut(s) 1838
MhlI GDGCHC 7 cut(s) 120, 304, 3408, 4701, 4861, 5748, 5950
MlsI TGGCCA 4 cut(s) 1878, 3523, 5035, 5633
MluI ACGCGT 1 cut(s) 286
MluNI TGGCCA 4 cut(s) 1878, 3523, 5035, 5633
Mly113I GGCGCC 3 cut(s) 2012, 2107, 4327
MlyI GAGTC 7 cut(s) 911, 1366, 2582, 3196, 3280, 4204, 5707
MmeI TCCRAC 7 cut(s) 687, 2417, 2550, 3243, 4847, 5733, 6626
Mox20I TGGCCA 4 cut(s) 1878, 3523, 5035, 5633
Mph1103I ATGCAT 3 cut(s) 2193, 2881, 4812
MroXI GAANNNNTTC 4 cut(s) 269, 1278, 4962, 6461
MscI TGGCCA 4 cut(s) 1878, 3523, 5035, 5633
Msp20I TGGCCA 4 cut(s) 1878, 3523, 5035, 5633
MspA1I CMGCKG 7 cut(s) 65, 1319, 4213, 4273, 5572, 5737, 6238
MspCI CTTAAG 1 cut(s) 5813
MspI CCGG 7 cut(s) 98, 796, 838, 1735, 3364, 3946, 7051
MunI CAATTG 1 cut(s) 1838
Mva1269I GAATGC 5 cut(s) 618, 936, 3737, 5730, 5918
MvnI CGCG 2 cut(s) 65, 288
NarI GGCGCC 3 cut(s) 2012, 2107, 4327
NciI CCSGG 3 cut(s) 1735, 3364, 3947
NcoI CCATGG 3 cut(s) 247, 1125, 6956
NdeI CATATG 2 cut(s) 2518, 4417
NmeAIII GCCGAG 2 cut(s) 133, 5905
NsiI ATGCAT 3 cut(s) 2193, 2881, 4812
NspI RCATGY 7 cut(s) 214, 227, 259, 323, 1630, 3688, 5200
NspV TTCGAA 1 cut(s) 263
OliI CACNNNNGTG 5 cut(s) 4864, 5222, 5595, 6571, 7100
PaeI GCATGC 1 cut(s) 323
PaeR7I CTCGAG 3 cut(s) 338, 3288, 7067
PagI TCATGA 4 cut(s) 3427, 3546, 4198, 7039
PasI CCCWGGG 1 cut(s) 357
PciI ACATGT 2 cut(s) 255, 5196
PciSI GCTCTTC 4 cut(s) 2700, 3683, 5682, 6615
PcsI WCGNNNNNNNCGW 3 cut(s) 285, 2764, 5161
PctI GAATGC 5 cut(s) 618, 936, 3737, 5730, 5918
PdmI GAANNNNTTC 4 cut(s) 269, 1278, 4962, 6461
PflMI CCANNNNNTGG 4 cut(s) 35, 5534, 5564, 6738
PfoI TCCNGGA 1 cut(s) 3945
PleI GAGTC 7 cut(s) 910, 1366, 2581, 3195, 3280, 4203, 5707
PluTI GGCGCC 3 cut(s) 2015, 2110, 4330
PpsI GAGTC 7 cut(s) 910, 1366, 2581, 3195, 3280, 4203, 5707
Ppu21I YACGTR 1 cut(s) 3815
PscI ACATGT 2 cut(s) 255, 5196
PshAI GACNNNNGTC 1 cut(s) 2916
PshBI ATTAAT 2 cut(s) 4749, 5532
PsiI TTATAA 3 cut(s) 1623, 1680, 2979
Psp1406I AACGTT 1 cut(s) 5155
PspEI GGTNACC 2 cut(s) 1035, 6872
PspFI CCCAGC 2 cut(s) 1199, 4269
PspXI VCTCGAGB 2 cut(s) 3288, 7067
PstI CTGCAG 5 cut(s) 1857, 2950, 3802, 5793, 6773
PstNI CAGNNNCTG 2 cut(s) 35, 1319
PvuII CAGCTG 4 cut(s) 1319, 4213, 5572, 6238
SacII CCGCGG 1 cut(s) 66
SalI GTCGAC 1 cut(s) 597
SapI GCTCTTC 4 cut(s) 2700, 3683, 5682, 6615
ScaI AGTACT 2 cut(s) 5102, 7034
SchI GAGTC 7 cut(s) 911, 1366, 2582, 3196, 3280, 4204, 5707
SduI GDGCHC 7 cut(s) 120, 304, 3408, 4701, 4861, 5748, 5950
SexAI ACCWGGT 2 cut(s) 2305, 4458
SfcI CTRYAG 9 cut(s) 1572, 1853, 2415, 2946, 3798, 4531, 5397, 5789, 6769
SfoI GGCGCC 3 cut(s) 2013, 2108, 4328
Sfr274I CTCGAG 3 cut(s) 338, 3288, 7067
Sfr303I CCGCGG 1 cut(s) 66
SfuI TTCGAA 1 cut(s) 263
SgrBI CCGCGG 1 cut(s) 66
SlaI CTCGAG 3 cut(s) 338, 3288, 7067
SmlI CTYRAG 6 cut(s) 338, 2861, 3288, 4311, 5813, 7067
SmoI CTYRAG 6 cut(s) 338, 2861, 3288, 4311, 5813, 7067
SpeI ACTAGT 2 cut(s) 3985, 6299
SphI GCATGC 1 cut(s) 323
SspDI GGCGCC 3 cut(s) 2011, 2106, 4326
SspI AATATT 2 cut(s) 2290, 4851
SspMI CTAG 9 cut(s) 296, 686, 761, 3116, 3986, 4047, 5049, 6255, 6300
TaiI ACGT 8 cut(s) 1222, 2401, 2920, 3115, 3817, 5158, 5349, 6114
TaqII GACCGA 2 cut(s) 1023, 6350
TauI GCSGC 3 cut(s) 28, 68, 94
TspGWI ACGGA 9 cut(s) 263, 359, 452, 1419, 1802, 2595, 4521, 4844, 5380
Van91I CCANNNNNTGG 4 cut(s) 35, 5534, 5564, 6738
Vha464I CTTAAG 1 cut(s) 5813
VneI GTGCAC 4 cut(s) 3404, 4857, 5744, 5946
VspI ATTAAT 2 cut(s) 4749, 5532
XbaI TCTAGA 1 cut(s) 685
XceI RCATGY 7 cut(s) 214, 227, 259, 323, 1630, 3688, 5200
XcmI CCANNNNNNNNNTGG 1 cut(s) 6021
XhoI CTCGAG 3 cut(s) 338, 3288, 7067
XmiI GTMKAC 2 cut(s) 598, 3881
XmnI GAANNNNTTC 4 cut(s) 269, 1278, 4962, 6461
XspI CTAG 9 cut(s) 296, 686, 761, 3116, 3986, 4047, 5049, 6255, 6300
ZrmI AGTACT 2 cut(s) 5102, 7034
Zsp2I ATGCAT 3 cut(s) 2193, 2881, 4812
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.