MD12G1060800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
7072111 .. 7072475
365 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1060800.v1.1.491

Sequence Viewer

Length: 216 bp
ATGACTGCCTATTTAATTTACTGGTTTACTTCTCGGAATGTCAGCCACATTATGTTATCTGGACCTGTTGGTGATGTACTTGTCTGGCTAGAGAATTTAAGAGAAGTGGATTTGTCAAAGAATTACTTCACCGAGATAACCAAAACCCTTCCGATGCTAAGTTGTGAGTGGTATTTTGGTTTAGTGTATTGTTTCCATTCCACCTTACATTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.43

Weight (kDa)

5.78

Isoelectric Point (pI)

29.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000664)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 94
AfaI GTAC 1 cut(s) 78
ApoI RAATTY 1 cut(s) 94
Asp700I GAANNNNTTC 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 62
AsuHPI GGTGA 2 cut(s) 83, 121
AvaII GGWCC 1 cut(s) 62
BfaI CTAG 1 cut(s) 89
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 62
BmsI GCATC 1 cut(s) 144
Bse1I ACTGG 1 cut(s) 26
BseNI ACTGG 1 cut(s) 26
BsrI ACTGG 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 77
CviJI RGCY 2 cut(s) 45, 88
CviKI_1 RGCY 2 cut(s) 45, 88
CviQI GTAC 1 cut(s) 77
DdeI CTNAG 1 cut(s) 158
Eco47I GGWCC 1 cut(s) 62
FaiI YATR 1 cut(s) 53
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FspBI CTAG 1 cut(s) 89
HphI GGTGA 2 cut(s) 83, 121
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 2 cut(s) 36, 153
Hpy188III TCNNGA 1 cut(s) 60
Hpy8I GTNNAC 1 cut(s) 27
HpyAV CCTTC 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 158
LpnPI CCDG 4 cut(s) 7, 45, 70, 78
LweI GCATC 1 cut(s) 144
MaeI CTAG 1 cut(s) 89
MluCI AATT 3 cut(s) 15, 94, 121
MroXI GAANNNNTTC 1 cut(s) 125
MseI TTAA 3 cut(s) 14, 98, 214
PdmI GAANNNNTTC 1 cut(s) 125
PspPI GGNCC 1 cut(s) 62
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
SaqAI TTAA 3 cut(s) 14, 98, 214
Sau96I GGNCC 1 cut(s) 62
SetI ASST 2 cut(s) 67, 206
SfaNI GCATC 1 cut(s) 144
SgeI CNNG 8 cut(s) 34, 45, 72, 77, 92, 97, 101, 145
SinI GGWCC 1 cut(s) 62
Sse9I AATT 3 cut(s) 15, 94, 121
SspMI CTAG 1 cut(s) 89
TasI AATT 3 cut(s) 15, 94, 121
TatI WGTACW 1 cut(s) 76
Tru1I TTAA 3 cut(s) 14, 98, 214
Tru9I TTAA 3 cut(s) 14, 98, 214
VpaK11BI GGWCC 1 cut(s) 62
XapI RAATTY 1 cut(s) 94
XmnI GAANNNNTTC 1 cut(s) 125
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.