Rh1DG113400

Protein STRUBBELIG-RECEPTOR FAMILY 2-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
20855656 .. 20856775
1120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG113400.1

Sequence Viewer

Length: 246 bp
ATGAAAAGTCTCCGACATTTGAATCTAAGCCACAATTTGTTATCTGGACCCATTGGCAATGTTTTTCCAGGCCTACAGAATTTAAGAGAAATAGAAAAGAATGATCTGTTTCCTTCCAACAATTCACATTACCGTCGTGGTATCTGTCAAGCTTTCACAGGAGGAACTAATGGCTCAATTACCATCTTTTCTGCCTGCATTGAAGTGTCTGGAAACCAGAGTGCTGATGTTCGCAAGAATTACTAA

Protein Analysis

81

Amino Acids

8.92

Weight (kDa)

9.24

Isoelectric Point (pI)

54.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000664)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 79
AgsI TTSAA 2 cut(s) 22, 203
AjnI CCWGG 1 cut(s) 67
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
Alw26I GTCTC 1 cut(s) 14
AoxI GGCC 1 cut(s) 70
ApoI RAATTY 1 cut(s) 79
AspS9I GGNCC 1 cut(s) 47
AvaII GGWCC 1 cut(s) 47
BccI CCATC 1 cut(s) 191
BciT130I CCWGG 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 14
BfmI CTRYAG 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 69
Bme18I GGWCC 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 47
BmiI GGNNCC 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 69
Bse3DI GCAATG 1 cut(s) 64
BseBI CCWGG 1 cut(s) 69
BseMI GCAATG 1 cut(s) 64
BshFI GGCC 1 cut(s) 72
BsmAI GTCTC 1 cut(s) 14
BsnI GGCC 1 cut(s) 72
Bsp143I GATC 1 cut(s) 103
BspANI GGCC 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 49
BsrDI GCAATG 1 cut(s) 64
BssMI GATC 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 196
BstDEI CTNAG 1 cut(s) 26
BstKTI GATC 1 cut(s) 106
BstMAI GTCTC 1 cut(s) 14
BstMBI GATC 1 cut(s) 103
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 67
BstSFI CTRYAG 1 cut(s) 74
BsuRI GGCC 1 cut(s) 72
Cac8I GCNNGC 1 cut(s) 196
Cfr13I GGNCC 1 cut(s) 47
CviJI RGCY 4 cut(s) 30, 72, 152, 174
CviKI_1 RGCY 4 cut(s) 30, 72, 152, 174
DdeI CTNAG 1 cut(s) 26
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Eco147I AGGCCT 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 47
EcoRII CCWGG 1 cut(s) 67
HaeIII GGCC 1 cut(s) 72
HindIII AAGCTT 1 cut(s) 150
HinfI GANTC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 14
Hpy188III TCNNGA 2 cut(s) 45, 210
Hpy99I CGWCG 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 123
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 198
HpyF3I CTNAG 1 cut(s) 26
Kzo9I GATC 1 cut(s) 103
LpnPI CCDG 7 cut(s) 30, 54, 81, 144, 195, 208, 230
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MluCI AATT 5 cut(s) 34, 79, 121, 177, 238
MmeI TCCRAC 2 cut(s) 37, 141
MnlI CCTC 1 cut(s) 155
MseI TTAA 1 cut(s) 83
MslI CAYNNNNRTG 1 cut(s) 203
MspR9I CCNGG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 69
NdeII GATC 1 cut(s) 103
NlaIV GGNNCC 1 cut(s) 49
PceI AGGCCT 1 cut(s) 72
PfeI GAWTC 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 1 cut(s) 47
RseI CAYNNNNRTG 1 cut(s) 203
SaqAI TTAA 1 cut(s) 83
Sau3AI GATC 1 cut(s) 103
Sau96I GGNCC 1 cut(s) 47
ScrFI CCNGG 1 cut(s) 69
SetI ASST 1 cut(s) 154
SfcI CTRYAG 1 cut(s) 74
SgeI CNNG 9 cut(s) 57, 80, 81, 149, 161, 171, 207, 222, 229
SinI GGWCC 1 cut(s) 47
SmiMI CAYNNNNRTG 1 cut(s) 203
Sse9I AATT 5 cut(s) 34, 79, 121, 177, 238
SseBI AGGCCT 1 cut(s) 72
StuI AGGCCT 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 67
TaaI ACNGT 1 cut(s) 134
TasI AATT 5 cut(s) 34, 79, 121, 177, 238
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 47
XapI RAATTY 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.