Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002679.1

Orthogroup ID

OG0000664

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 529

Gene Structure 529 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002679.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 236 bp

atgcacaccacctgtttgatgaaagttccagtcgtagctcttaatgaactttacaagaccctcaaccaacctccacggctgacgggttggagattggatggtggggatccttgcgatgaatcgtggaatggagtgtcatgctttggctcttctgtgatataccttaaacttaatggtctaaacctctctgggtatattactgccgagatctataatctctacagtttgaagcaact

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0023052 GO:0036211 GO:0038023 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0060089 GO:0065007 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05169 map04010 map04064 map04620 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05169

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

79

Amino Acids

8.83

Weight (kDa)

6.52

Isoelectric Point (pI)

36.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000664)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G06820
fragaria_vesca	FvH4_6g22260 FvH4_6g22260 FvH4_6g22260 FvH4_6g22370 FvH4_6g22660 FvH4_6g22660
malus_domestica	MD12G1060500.v1.1 MD12G1060800.v1.1 MD13G1140200.v1.1 MD14G1060500.v1.1
prunus_persica	Prupe.6G256200_v2.0.a1 Prupe.6G256200_v2.0.a1 Prupe.7G074000_v2.0.a1 Prupe.7G074000_v2.0.a1
pyrus_communis	pycom14g04900
rosa_chinensis	RchiOBHm_Chr2g0158881 RchiOBHm_Chr3g0476831 RchiOBHm_Chr3g0476851 RchiOBHm_Chr3g0476861 RchiOBHm_Chr3g0480221
rosa_laevigata	RLG00000021120 RLG00000023509 RLG00000023748 RLG00000024125 RLG00000029770 RLG00000029771
rosa_multiflora	Rmu_co8335633.1_g000001 Rmu_sc0002267.1_g000010 Rmu_sc0002679.1_g000001 Rmu_sc0006148.1_g000002 Rmu_sc0008085.1_g000009 Rmu_sc0009296.1_g000001 Rmu_sc0009296.1_g000015 Rmu_sc0014404.1_g000008 Rmu_sc0041425.1_g000001
rosa_roxburghii	Rroxscaffold_2G00090920 Rroxscaffold_4G00319720 Rroxscaffold_4G00319850 Rroxscaffold_6G00401690 Rroxscaffold_6G00404530 Rroxscaffold_6G00404980 Rroxscaffold_6G00409500
rosa_rugosa	Rorug02G0473000 Rorug03G0157100 Rorug03G0181200 Rorug03G0181300
rosa_samantha	Rh1AG112100 Rh1CG109100 Rh1DG113400 Rh1DG117300 Rh2AG539100 Rh2BG551800 Rh2BG551900 Rh2CG522500 Rh2DG561600 Rh3AG171500 Rh3AG207000 Rh3AG207400 Rh3AG233000 Rh3BG197100 Rh3BG239900 Rh3BG240000 Rh3BG265600 Rh3CG188000 Rh3CG188100 Rh3CG233700 Rh3CG262800 Rh3DG177300 Rh3DG177400 Rh3DG233700 Rh3DG258800
rosa_wichuraiana	Rw0G002320 Rw3G016860 Rw3G020460 Rw3G020930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	101, 114
AgsI	TTSAA	1 cut(s)	229
AluBI	AGCT	1 cut(s)	38
AluI	AGCT	1 cut(s)	38
AlwI	GGATC	2 cut(s)	101, 114
BamHI	GGATCC	1 cut(s)	106
BccI	CCATC	1 cut(s)	92
BceAI	ACGGC	1 cut(s)	92
BfmI	CTRYAG	1 cut(s)	220
BglII	AGATCT	1 cut(s)	207
BmiI	GGNNCC	1 cut(s)	108
BsaJI	CCNNGG	1 cut(s)	74
Bse1I	ACTGG	1 cut(s)	29
BseDI	CCNNGG	1 cut(s)	74
BseGI	GGATG	1 cut(s)	103
BseNI	ACTGG	1 cut(s)	29
Bsp143I	GATC	2 cut(s)	106, 207
BspLI	GGNNCC	1 cut(s)	108
BspPI	GGATC	2 cut(s)	101, 114
BspQI	GCTCTTC	1 cut(s)	154
BsrI	ACTGG	1 cut(s)	29
BssECI	CCNNGG	1 cut(s)	74
BssMI	GATC	2 cut(s)	106, 207
Bst4CI	ACNGT	1 cut(s)	224
Bst6I	CTCTTC	1 cut(s)	154
BstDSI	CCRYGG	1 cut(s)	74
BstF5I	GGATG	1 cut(s)	103
BstKTI	GATC	2 cut(s)	109, 210
BstMBI	GATC	2 cut(s)	106, 207
BstSFI	CTRYAG	1 cut(s)	220
BstX2I	RGATCY	2 cut(s)	106, 207
BstYI	RGATCY	2 cut(s)	106, 207
BtgI	CCRYGG	1 cut(s)	74
BtgZI	GCGATG	1 cut(s)	129
BtsCI	GGATG	1 cut(s)	103
CviAII	CATG	1 cut(s)	138
CviJI	RGCY	3 cut(s)	38, 79, 147
CviKI_1	RGCY	3 cut(s)	38, 79, 147
DpnI	GATC	2 cut(s)	108, 209
DpnII	GATC	2 cut(s)	106, 207
Eam1104I	CTCTTC	1 cut(s)	154
EarI	CTCTTC	1 cut(s)	154
FaeI	CATG	1 cut(s)	141
FaiI	YATR	4 cut(s)	139, 160, 195, 213
FatI	CATG	1 cut(s)	137
FokI	GGATG	1 cut(s)	110
Hin1II	CATG	1 cut(s)	141
HinfI	GANTC	1 cut(s)	119
HpyCH4III	ACNGT	1 cut(s)	224
HpyCH4V	TGCA	1 cut(s)	4
Hsp92II	CATG	1 cut(s)	141
Kzo9I	GATC	2 cut(s)	106, 207
LguI	GCTCTTC	1 cut(s)	154
LpnPI	CCDG	3 cut(s)	25, 42, 174
MalI	GATC	2 cut(s)	108, 209
MboI	GATC	2 cut(s)	106, 207
MboII	GAAGA	1 cut(s)	141
MflI	RGATCY	2 cut(s)	106, 207
MmeI	TCCRAC	1 cut(s)	68
MnlI	CCTC	3 cut(s)	71, 81, 194
MseI	TTAA	3 cut(s)	42, 165, 171
NdeII	GATC	2 cut(s)	106, 207
NlaIII	CATG	1 cut(s)	141
NlaIV	GGNNCC	1 cut(s)	108
NmeAIII	GCCGAG	1 cut(s)	229
PciSI	GCTCTTC	1 cut(s)	154
PfeI	GAWTC	1 cut(s)	119
PspN4I	GGNNCC	1 cut(s)	108
PsuI	RGATCY	2 cut(s)	106, 207
SapI	GCTCTTC	1 cut(s)	154
SaqAI	TTAA	3 cut(s)	42, 165, 171
Sau3AI	GATC	2 cut(s)	106, 207
SetI	ASST	5 cut(s)	14, 40, 73, 165, 186
SfcI	CTRYAG	1 cut(s)	220
TaaI	ACNGT	1 cut(s)	224
TfiI	GAWTC	1 cut(s)	119
Tru1I	TTAA	3 cut(s)	42, 165, 171
Tru9I	TTAA	3 cut(s)	42, 165, 171
TspDTI	ATGAA	3 cut(s)	35, 60, 132

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.