Rh2BG551800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
76044909 .. 76045178
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG551800.1

Sequence Viewer

Length: 270 bp
ATGGCAGCCCACCAGGATGCAAACAATGAACCACCACCTGAGCTGCCTGCTCGGCTTCAATTTTCTCCCCCGAGGCCACCTGAGAGGCTAGAACTTGATGGCAGGTTCATTGCAGGACAGAATTACGAAATAATTGTTGCTGGTAAAGCCTATCATGCTGATACAGAAGAAAAAGTAGTGAAGAAAGCAAAGAAAGACCAAGAGCCAGAGGAACCCCCTCCACAAGTTAAACTTGACACTTTCATCGACCATGTTGAGGAAAATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.08

Weight (kDa)

4.79

Isoelectric Point (pI)

63.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000664)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 256
AgsI TTSAA 1 cut(s) 59
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
Ama87I CYCGRG 1 cut(s) 70
AoxI GGCC 1 cut(s) 74
ApeKI GCWGC 2 cut(s) 5, 43
AvaI CYCGRG 1 cut(s) 70
BbvI GCAGC 2 cut(s) 17, 30
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 14
BfaI CTAG 1 cut(s) 89
BfuAI ACCTGC 1 cut(s) 93
BglI GCCNNNNNGGC 1 cut(s) 52
BisI GCNGC 2 cut(s) 6, 44
BlsI GCNGC 2 cut(s) 7, 45
Bme1390I CCNGG 1 cut(s) 14
BmeT110I CYCGRG 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 213
BmrFI CCNGG 1 cut(s) 14
BmsI GCATC 1 cut(s) 7
Bpu10I CCTNAGC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 256
Bse3DI GCAATG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 14
BseDI CCNNGG 1 cut(s) 71
BseGI GGATG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 256
BseMI GCAATG 1 cut(s) 108
BseMII CTCAG 2 cut(s) 30, 72
BseXI GCAGC 2 cut(s) 17, 30
BshFI GGCC 1 cut(s) 76
BsiHKCI CYCGRG 1 cut(s) 70
BslI CCNNNNNNNGG 1 cut(s) 256
BsnI GGCC 1 cut(s) 76
BsoBI CYCGRG 1 cut(s) 70
BspANI GGCC 1 cut(s) 76
BspCNI CTCAG 2 cut(s) 31, 73
BspLI GGNNCC 1 cut(s) 213
BspMI ACCTGC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 108
BssECI CCNNGG 1 cut(s) 71
Bst2UI CCWGG 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 2 cut(s) 39, 81
BstF5I GGATG 1 cut(s) 22
BstMWI GCNNNNNNNGC 3 cut(s) 52, 146, 155
BstNI CCWGG 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 12
BstV1I GCAGC 2 cut(s) 17, 30
BsuRI GGCC 1 cut(s) 76
BtsCI GGATG 1 cut(s) 22
BveI ACCTGC 1 cut(s) 93
Cac8I GCNNGC 1 cut(s) 48
CviAII CATG 2 cut(s) 155, 251
CviJI RGCY 7 cut(s) 8, 43, 55, 76, 88, 149, 205
CviKI_1 RGCY 7 cut(s) 8, 43, 55, 76, 88, 149, 205
DdeI CTNAG 2 cut(s) 39, 81
Eco88I CYCGRG 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 12
FaeI CATG 2 cut(s) 158, 254
FaiI YATR 2 cut(s) 156, 252
FalI AAGNNNNNCTT 2 cut(s) 216, 248
FatI CATG 2 cut(s) 154, 250
Fnu4HI GCNGC 2 cut(s) 6, 44
FokI GGATG 1 cut(s) 29
Fsp4HI GCNGC 2 cut(s) 6, 44
FspBI CTAG 1 cut(s) 89
GluI GCNGC 2 cut(s) 6, 44
HaeIII GGCC 1 cut(s) 76
Hin1II CATG 2 cut(s) 158, 254
HpyCH4V TGCA 2 cut(s) 20, 113
HpyF10VI GCNNNNNNNGC 3 cut(s) 52, 146, 155
HpyF3I CTNAG 2 cut(s) 39, 81
Hsp92II CATG 2 cut(s) 158, 254
LpnPI CCDG 8 cut(s) 26, 51, 60, 88, 93, 99, 126, 219
Lsp1109I GCAGC 2 cut(s) 17, 30
LweI GCATC 1 cut(s) 7
MaeI CTAG 1 cut(s) 89
MboII GAAGA 2 cut(s) 179, 193
MluCI AATT 3 cut(s) 59, 121, 132
MnlI CCTC 5 cut(s) 66, 78, 202, 228, 250
MseI TTAA 1 cut(s) 228
MslI CAYNNNNRTG 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
MwoI GCNNNNNNNGC 3 cut(s) 52, 146, 155
NlaIII CATG 2 cut(s) 158, 254
NlaIV GGNNCC 1 cut(s) 213
NmeAIII GCCGAG 1 cut(s) 31
PkrI GCNGC 2 cut(s) 7, 45
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PspN4I GGNNCC 1 cut(s) 213
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 1 cut(s) 228
SatI GCNGC 2 cut(s) 6, 44
ScrFI CCNGG 1 cut(s) 14
SetI ASST 4 cut(s) 40, 45, 82, 107
SfaNI GCATC 1 cut(s) 7
SmiMI CAYNNNNRTG 1 cut(s) 15
Sse9I AATT 3 cut(s) 59, 121, 132
SspMI CTAG 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 12
TaqI TCGA 1 cut(s) 246
TasI AATT 3 cut(s) 59, 121, 132
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TseI GCWGC 2 cut(s) 5, 43
TspDTI ATGAA 3 cut(s) 42, 97, 232
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.