Prupe.1G097800_v2.0.a1

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0000890
Physical Location & Seq
Forward (+)
7811757 .. 7813363
1607 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G097800.1

Sequence Viewer

Length: 462 bp
ATGGCGACTGATTCTTTTGCAATGTCAATGCTGCCCTTGGGGGTGGGGTGGGAGCATAAGGGGAGGCTAAATTTGCGGGGTTGCTCCAAAATCGGGGCCCTCCAAAATAGAAAGTCCTGTGCGATGGGTTTCTCTGTGAATCTGGGCTATGGTTCTGTCATTGAAGTTGAGTTATGGGGAATTTTTTGGGGGCTTAGTATGGCTTGGGATGCTGACTTTCGCACAGTGGAGATTGAGTGTGATTCTACTTCTGCTGTGGCTTTGTTAAAAAGTCCTATTGACTGGTGCTGCTATGTGAAGCATATTTTCCGTGAACAAAATTGTGCTGCGGATGCTCTTACTGTGAAGTGTTATGATTTTGATCCTGGGCTCCATGTGTTTCTTGAGGCTCCAGCCTTTCTTAGTGATGTGTTAGCTGCTAATGTTCGAGGTGCTGTTAGACCTCGGCTTGTTTCTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

154

Amino Acids

16.82

Weight (kDa)

5.87

Isoelectric Point (pI)

40.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000890)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G42905
fragaria_vesca FvH4_1g15070 FvH4_1g21661 FvH4_1g24182 FvH4_2g15861 FvH4_7g26563
prunus_persica Prupe.1G097800_v2.0.a1 Prupe.1G446500_v2.0.a1 Prupe.4G161900_v2.0.a1 Prupe.5G085900_v2.0.a1 Prupe.6G118100_v2.0.a1 Prupe.6G201000_v2.0.a1 Prupe.7G199700_v2.0.a1
pyrus_communis pycom07g22740 pycom15g37390 pycom420g00480 pycom420g00490
rosa_chinensis RchiOBHm_Chr1g0319821 RchiOBHm_Chr1g0331331 RchiOBHm_Chr2g0144631 RchiOBHm_Chr2g0146161 RchiOBHm_Chr2g0152401 RchiOBHm_Chr3g0484381 RchiOBHm_Chr3g0484471 RchiOBHm_Chr3g0494391 RchiOBHm_Chr4g0411801 RchiOBHm_Chr4g0426191 RchiOBHm_Chr5g0016411 RchiOBHm_Chr5g0074971 RchiOBHm_Chr6g0262791 RchiOBHm_Chr6g0272021 RchiOBHm_Chr7g0181271 RchiOBHm_Chr7g0224511 RchiOBHm_Chr7g0225251
rosa_laevigata RLG00000017287
rosa_multiflora Rmu_co8215414.1_g000001 Rmu_sc0001850.1_g000028 Rmu_sc0002132.1_g000045 Rmu_sc0003623.1_g000032 Rmu_sc0003826.1_g000010 Rmu_sc0004165.1_g000032 Rmu_sc0004805.1_g000052 Rmu_sc0005837.1_g000007 Rmu_sc0011261.1_g000003 Rmu_sc0012066.1_g000001 Rmu_sc0021240.1_g000002 Rmu_sc0028377.1_g000003 Rmu_ssc0000454.1_g000003
rosa_roxburghii Rroxscaffold_177G00434230 Rroxscaffold_180G00433210 Rroxscaffold_1G00050960 Rroxscaffold_2G00112540 Rroxscaffold_7G00172420
rosa_rugosa Rorug02G0446000 Rorug03G0370600 Rorug04G0217600.1 Rorug07G0160200 Rorug07G0292300.1
rosa_samantha Rh3AG161100 Rh5AG403600 Rh5CG315600 Rh5CG315800 Rh6BG408500 Rh7CG313500
rosa_wichuraiana Rw4G023910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 76, 329
AclWI GGATC 1 cut(s) 356
AcsI RAATTY 2 cut(s) 70, 180
AfiI CCNNNNNNNGG 1 cut(s) 93
AgsI TTSAA 1 cut(s) 164
AjnI CCWGG 1 cut(s) 364
AluBI AGCT 1 cut(s) 416
AluI AGCT 1 cut(s) 416
AlwI GGATC 1 cut(s) 356
AoxI GGCC 1 cut(s) 96
ApaI GGGCCC 1 cut(s) 100
ApeKI GCWGC 4 cut(s) 31, 288, 326, 416
ApoI RAATTY 2 cut(s) 70, 180
AspS9I GGNCC 2 cut(s) 96, 97
BaeGI GKGCMC 1 cut(s) 100
BanII GRGCYC 2 cut(s) 100, 372
BbvI GCAGC 4 cut(s) 18, 275, 313, 403
BccI CCATC 1 cut(s) 118
BciT130I CCWGG 1 cut(s) 366
BisI GCNGC 4 cut(s) 32, 289, 327, 417
BlsI GCNGC 4 cut(s) 33, 290, 328, 418
Bme1390I CCNGG 1 cut(s) 366
BmgT120I GGNCC 2 cut(s) 96, 97
BmiI GGNNCC 4 cut(s) 97, 98, 371, 390
BmrFI CCNGG 1 cut(s) 366
BmsI GCATC 2 cut(s) 199, 322
BpmI CTGGAG 1 cut(s) 375
BpuEI CTTGAG 1 cut(s) 404
BsaBI GATNNNNATC 1 cut(s) 360
BsaJI CCNNGG 3 cut(s) 36, 365, 443
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 287
Bse3DI GCAATG 1 cut(s) 27
Bse8I GATNNNNATC 1 cut(s) 360
BseBI CCWGG 1 cut(s) 366
BseDI CCNNGG 3 cut(s) 36, 365, 443
BseGI GGATG 2 cut(s) 214, 337
BseJI GATNNNNATC 1 cut(s) 360
BseLI CCNNNNNNNGG 1 cut(s) 93
BseMI GCAATG 1 cut(s) 27
BseNI ACTGG 1 cut(s) 287
BseSI GKGCMC 1 cut(s) 100
BseXI GCAGC 4 cut(s) 18, 275, 313, 403
BshFI GGCC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 93
BsnI GGCC 1 cut(s) 98
Bsp120I GGGCCC 1 cut(s) 96
Bsp1286I GDGCHC 2 cut(s) 100, 372
Bsp143I GATC 1 cut(s) 361
BspACI CCGC 2 cut(s) 76, 329
BspANI GGCC 1 cut(s) 98
BspLI GGNNCC 4 cut(s) 97, 98, 371, 390
BspPI GGATC 1 cut(s) 356
BsrDI GCAATG 1 cut(s) 27
BsrI ACTGG 1 cut(s) 287
BssECI CCNNGG 3 cut(s) 36, 365, 443
BssMI GATC 1 cut(s) 361
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 366
Bst4CI ACNGT 2 cut(s) 226, 343
BstDEI CTNAG 2 cut(s) 194, 401
BstF5I GGATG 2 cut(s) 214, 337
BstKTI GATC 1 cut(s) 364
BstMBI GATC 1 cut(s) 361
BstMWI GCNNNNNNNGC 3 cut(s) 73, 209, 332
BstNI CCWGG 1 cut(s) 366
BstSCI CCNGG 1 cut(s) 364
BstSLI GKGCMC 1 cut(s) 100
BstV1I GCAGC 4 cut(s) 18, 275, 313, 403
BsuRI GGCC 1 cut(s) 98
BtgZI GCGATG 1 cut(s) 137
BtsCI GGATG 2 cut(s) 214, 337
BtsIMutI CAGTG 1 cut(s) 231
Cfr13I GGNCC 2 cut(s) 96, 97
CviAII CATG 1 cut(s) 374
DdeI CTNAG 2 cut(s) 194, 401
DpnI GATC 1 cut(s) 363
DpnII GATC 1 cut(s) 361
Eco130I CCWWGG 1 cut(s) 36
Eco24I GRGCYC 2 cut(s) 100, 372
EcoO109I RGGNCCY 2 cut(s) 96, 97
EcoRII CCWGG 1 cut(s) 364
EcoT14I CCWWGG 1 cut(s) 36
EcoT38I GRGCYC 2 cut(s) 100, 372
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 377
FaiI YATR 8 cut(s) 57, 150, 175, 200, 294, 303, 354, 375
FatI CATG 1 cut(s) 373
FauI CCCGC 1 cut(s) 69
Fnu4HI GCNGC 4 cut(s) 32, 289, 327, 417
FokI GGATG 2 cut(s) 221, 344
FriOI GRGCYC 2 cut(s) 100, 372
Fsp4HI GCNGC 4 cut(s) 32, 289, 327, 417
GluI GCNGC 4 cut(s) 32, 289, 327, 417
GsuI CTGGAG 1 cut(s) 375
HaeIII GGCC 1 cut(s) 98
Hin1II CATG 1 cut(s) 377
HinfI GANTC 3 cut(s) 11, 139, 242
Hpy166II GTNNAC 1 cut(s) 314
Hpy188III TCNNGA 1 cut(s) 383
Hpy8I GTNNAC 1 cut(s) 314
HpyCH4III ACNGT 2 cut(s) 226, 343
HpyCH4V TGCA 1 cut(s) 20
HpyF10VI GCNNNNNNNGC 3 cut(s) 73, 209, 332
HpyF3I CTNAG 2 cut(s) 194, 401
Hsp92II CATG 1 cut(s) 377
Kzo9I GATC 1 cut(s) 361
LmnI GCTCC 4 cut(s) 52, 89, 375, 394
LpnPI CCDG 6 cut(s) 128, 130, 268, 351, 378, 405
Lsp1109I GCAGC 4 cut(s) 18, 275, 313, 403
LweI GCATC 2 cut(s) 199, 322
MalI GATC 1 cut(s) 363
MboI GATC 1 cut(s) 361
MhlI GDGCHC 2 cut(s) 100, 372
MluCI AATT 3 cut(s) 70, 180, 319
MnlI CCTC 5 cut(s) 57, 110, 379, 422, 453
MseI TTAA 1 cut(s) 266
MspR9I CCNGG 1 cut(s) 366
MvaI CCWGG 1 cut(s) 366
MwoI GCNNNNNNNGC 3 cut(s) 73, 209, 332
NdeII GATC 1 cut(s) 361
NlaIII CATG 1 cut(s) 377
NlaIV GGNNCC 4 cut(s) 97, 98, 371, 390
NmeAIII GCCGAG 1 cut(s) 424
PfeI GAWTC 3 cut(s) 11, 139, 242
PkrI GCNGC 4 cut(s) 33, 290, 328, 418
Psp6I CCWGG 1 cut(s) 364
PspGI CCWGG 1 cut(s) 364
PspN4I GGNNCC 4 cut(s) 97, 98, 371, 390
PspOMI GGGCCC 1 cut(s) 96
PspPI GGNCC 2 cut(s) 96, 97
SaqAI TTAA 1 cut(s) 266
SatI GCNGC 4 cut(s) 32, 289, 327, 417
Sau3AI GATC 1 cut(s) 361
Sau96I GGNCC 2 cut(s) 96, 97
ScrFI CCNGG 1 cut(s) 366
SduI GDGCHC 2 cut(s) 100, 372
SetI ASST 3 cut(s) 418, 433, 445
SfaNI GCATC 2 cut(s) 199, 322
SmlI CTYRAG 1 cut(s) 383
SmoI CTYRAG 1 cut(s) 383
Sse9I AATT 3 cut(s) 70, 180, 319
SsiI CCGC 2 cut(s) 76, 329
StyD4I CCNGG 1 cut(s) 364
StyI CCWWGG 1 cut(s) 36
TaaI ACNGT 2 cut(s) 226, 343
TaqI TCGA 1 cut(s) 427
TasI AATT 3 cut(s) 70, 180, 319
TfiI GAWTC 3 cut(s) 11, 139, 242
Tru1I TTAA 1 cut(s) 266
Tru9I TTAA 1 cut(s) 266
TscAI CASTG 1 cut(s) 231
TseI GCWGC 4 cut(s) 31, 288, 326, 416
TspGWI ACGGA 1 cut(s) 299
TspRI CASTG 1 cut(s) 231
XapI RAATTY 2 cut(s) 70, 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.