Rmu_sc0004805.1_g000052

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004805.1
Physical Location & Seq
Reverse (-)
256955 .. 257692
738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004805.1_g000052.1.cds

Sequence Viewer

Length: 375 bp
atgaaatcccacttctgtacaaacccaacttccttctcgagggtcttgaagttgtcaaatttcaccttggtgactgacttggtcaagacttcagctggaaacagatctggtaatattggagcaggtggtgtgctcagagtccaccatggaaattggattatgggtttttatgccaatcttggtactagttcagttattgttgctgaagcatggggcctccttggacttaagatggcctcccaacaaacaaggggcaagattgtagttgaatgtgattcagaggtgcttgttaatcttatggctaatggggttgatgatcttcatcctctcaaacctattatgagcagttgtagaattctcatggaacttctttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

13.39

Weight (kDa)

8.96

Isoelectric Point (pI)

35.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 113
Acc36I ACCTGC 1 cut(s) 113
AcsI RAATTY 2 cut(s) 58, 354
AcuI CTGAAG 2 cut(s) 75, 225
AfaI GTAC 2 cut(s) 19, 184
AfiI CCNNNNNNNGG 1 cut(s) 39
AflII CTTAAG 1 cut(s) 227
AgsI TTSAA 2 cut(s) 49, 269
AhlI ACTAGT 1 cut(s) 185
AleI CACNNNNGTG 1 cut(s) 68
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
Alw21I GWGCWC 1 cut(s) 135
Ama87I CYCGRG 1 cut(s) 37
AoxI GGCC 2 cut(s) 214, 234
ApoI RAATTY 2 cut(s) 58, 354
AspS9I GGNCC 1 cut(s) 214
AsuHPI GGTGA 2 cut(s) 55, 82
AvaI CYCGRG 1 cut(s) 37
Bbv12I GWGCWC 1 cut(s) 135
BccI CCATC 1 cut(s) 226
BcuI ACTAGT 1 cut(s) 185
BfaI CTAG 1 cut(s) 186
BfrI CTTAAG 1 cut(s) 227
BfuAI ACCTGC 1 cut(s) 113
BglII AGATCT 1 cut(s) 104
BmeT110I CYCGRG 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 214
BmiI GGNNCC 1 cut(s) 215
BsaBI GATNNNNATC 1 cut(s) 321
BsaJI CCNNGG 3 cut(s) 66, 145, 220
Bsc4I CCNNNNNNNGG 1 cut(s) 39
Bse8I GATNNNNATC 1 cut(s) 321
BseDI CCNNGG 3 cut(s) 66, 145, 220
BseGI GGATG 1 cut(s) 322
BseJI GATNNNNATC 1 cut(s) 321
BseLI CCNNNNNNNGG 1 cut(s) 39
BseMII CTCAG 1 cut(s) 148
BshFI GGCC 2 cut(s) 216, 236
BsiHKAI GWGCWC 1 cut(s) 135
BsiHKCI CYCGRG 1 cut(s) 37
BslI CCNNNNNNNGG 1 cut(s) 39
BsnI GGCC 2 cut(s) 216, 236
BsoBI CYCGRG 1 cut(s) 37
Bsp1286I GDGCHC 1 cut(s) 135
Bsp1407I TGTACA 1 cut(s) 17
Bsp143I GATC 2 cut(s) 104, 316
Bsp19I CCATGG 1 cut(s) 145
BspANI GGCC 2 cut(s) 216, 236
BspCNI CTCAG 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 215
BspMI ACCTGC 1 cut(s) 113
BspTI CTTAAG 1 cut(s) 227
BsrGI TGTACA 1 cut(s) 17
BssECI CCNNGG 3 cut(s) 66, 145, 220
BssMI GATC 2 cut(s) 104, 316
BssT1I CCWWGG 3 cut(s) 66, 145, 220
BstAFI CTTAAG 1 cut(s) 227
BstAUI TGTACA 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 134
BstDSI CCRYGG 1 cut(s) 145
BstENI CCTNNNNNAGG 1 cut(s) 37
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 2 cut(s) 107, 319
BstMBI GATC 2 cut(s) 104, 316
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
BsuRI GGCC 2 cut(s) 216, 236
BtgI CCRYGG 1 cut(s) 145
BtsCI GGATG 1 cut(s) 322
BveI ACCTGC 1 cut(s) 113
Cfr13I GGNCC 1 cut(s) 214
Csp6I GTAC 2 cut(s) 18, 183
CviAII CATG 3 cut(s) 146, 210, 361
CviJI RGCY 4 cut(s) 95, 216, 236, 302
CviKI_1 RGCY 4 cut(s) 95, 216, 236, 302
CviQI GTAC 2 cut(s) 18, 183
DdeI CTNAG 1 cut(s) 134
DpnI GATC 2 cut(s) 106, 318
DpnII GATC 2 cut(s) 104, 316
Eco130I CCWWGG 3 cut(s) 66, 145, 220
Eco57I CTGAAG 2 cut(s) 75, 225
Eco88I CYCGRG 1 cut(s) 37
EcoNI CCTNNNNNAGG 1 cut(s) 37
EcoO109I RGGNCCY 1 cut(s) 214
EcoRI GAATTC 1 cut(s) 354
EcoT14I CCWWGG 3 cut(s) 66, 145, 220
ErhI CCWWGG 3 cut(s) 66, 145, 220
FaeI CATG 3 cut(s) 149, 213, 364
FaiI YATR 7 cut(s) 147, 161, 171, 211, 299, 341, 362
FatI CATG 3 cut(s) 145, 209, 360
FokI GGATG 1 cut(s) 309
FspBI CTAG 1 cut(s) 186
HaeIII GGCC 2 cut(s) 216, 236
Hin1II CATG 3 cut(s) 149, 213, 364
HinfI GANTC 2 cut(s) 138, 275
HphI GGTGA 2 cut(s) 55, 82
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 137, 280
Hpy188III TCNNGA 3 cut(s) 37, 46, 85
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 3 cut(s) 149, 213, 364
Kzo9I GATC 2 cut(s) 104, 316
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 3 cut(s) 81, 93, 108
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 1 cut(s) 70
MalI GATC 2 cut(s) 106, 318
MboI GATC 2 cut(s) 104, 316
MboII GAAGA 1 cut(s) 311
MflI RGATCY 1 cut(s) 104
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 3 cut(s) 58, 151, 354
MlyI GAGTC 1 cut(s) 147
MnlI CCTC 5 cut(s) 33, 227, 247, 274, 336
MseI TTAA 2 cut(s) 228, 291
MslI CAYNNNNRTG 1 cut(s) 68
MspA1I CMGCKG 1 cut(s) 95
MspCI CTTAAG 1 cut(s) 227
NcoI CCATGG 1 cut(s) 145
NdeII GATC 2 cut(s) 104, 316
NlaIII CATG 3 cut(s) 149, 213, 364
NlaIV GGNNCC 1 cut(s) 215
NmuCI GTSAC 1 cut(s) 70
OliI CACNNNNGTG 1 cut(s) 68
PaeR7I CTCGAG 1 cut(s) 37
PaqCI CACCTGC 1 cut(s) 113
PfeI GAWTC 1 cut(s) 275
PflFI GACNNNGTC 1 cut(s) 80
PleI GAGTC 1 cut(s) 146
PpsI GAGTC 1 cut(s) 146
PspN4I GGNNCC 1 cut(s) 215
PspPI GGNCC 1 cut(s) 214
PsuI RGATCY 1 cut(s) 104
PsyI GACNNNGTC 1 cut(s) 80
PvuII CAGCTG 1 cut(s) 95
RsaI GTAC 2 cut(s) 19, 184
RsaNI GTAC 2 cut(s) 18, 183
RseI CAYNNNNRTG 1 cut(s) 68
SaqAI TTAA 2 cut(s) 228, 291
Sau3AI GATC 2 cut(s) 104, 316
Sau96I GGNCC 1 cut(s) 214
SchI GAGTC 1 cut(s) 147
SduI GDGCHC 1 cut(s) 135
SetI ASST 5 cut(s) 68, 97, 127, 285, 337
Sfr274I CTCGAG 1 cut(s) 37
SlaI CTCGAG 1 cut(s) 37
SmiMI CAYNNNNRTG 1 cut(s) 68
SmlI CTYRAG 2 cut(s) 37, 227
SmoI CTYRAG 2 cut(s) 37, 227
SpeI ACTAGT 1 cut(s) 185
Sse9I AATT 3 cut(s) 58, 151, 354
SspI AATATT 1 cut(s) 115
SspMI CTAG 1 cut(s) 186
StyI CCWWGG 3 cut(s) 66, 145, 220
TaqI TCGA 1 cut(s) 38
TasI AATT 3 cut(s) 58, 151, 354
TatI WGTACW 1 cut(s) 17
TfiI GAWTC 1 cut(s) 275
Tru1I TTAA 2 cut(s) 228, 291
Tru9I TTAA 2 cut(s) 228, 291
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspDTI ATGAA 2 cut(s) 17, 311
Tth111I GACNNNGTC 1 cut(s) 80
Vha464I CTTAAG 1 cut(s) 227
XagI CCTNNNNNAGG 1 cut(s) 37
XapI RAATTY 2 cut(s) 58, 354
XhoI CTCGAG 1 cut(s) 37
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.