Rmu_sc0011261.1_g000003

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011261.1
OG0000890
Physical Location & Seq
Forward (+)
5373 .. 5816
444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011261.1_g000003.1.cds

Sequence Viewer

Length: 444 bp
atggtgtttgatgaggggtttcactatccttttaatcctgggaaagttgttatagactctgctaactctttcaagcctcaacagtccagtaaatcttctgttagtttgtcttggaagaaaccccctgagcgttactttaaattaaatgttgatggtgctagaaatcttaatgggaaaattggtgctggtggtgtcttgagagatttcactggtgcttggatttctgggttttatgctaaccttggttgtgcttggggattacttttgggactacaaatggctctctctcatcattgccatcatcttctagtggaaagtgattctcatgtgttagtttccctagttcagcaaggtgtggatgatttgcaccccttaaagactattattgattgttgccaagctctccaaagacaattgcacatctatgatcttaagcatgtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

147

Amino Acids

16.33

Weight (kDa)

7.76

Isoelectric Point (pI)

36.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000890)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G42905
fragaria_vesca FvH4_1g15070 FvH4_1g21661 FvH4_1g24182 FvH4_2g15861 FvH4_7g26563
prunus_persica Prupe.1G097800_v2.0.a1 Prupe.1G446500_v2.0.a1 Prupe.4G161900_v2.0.a1 Prupe.5G085900_v2.0.a1 Prupe.6G118100_v2.0.a1 Prupe.6G201000_v2.0.a1 Prupe.7G199700_v2.0.a1
pyrus_communis pycom07g22740 pycom15g37390 pycom420g00480 pycom420g00490
rosa_chinensis RchiOBHm_Chr1g0319821 RchiOBHm_Chr1g0331331 RchiOBHm_Chr2g0144631 RchiOBHm_Chr2g0146161 RchiOBHm_Chr2g0152401 RchiOBHm_Chr3g0484381 RchiOBHm_Chr3g0484471 RchiOBHm_Chr3g0494391 RchiOBHm_Chr4g0411801 RchiOBHm_Chr4g0426191 RchiOBHm_Chr5g0016411 RchiOBHm_Chr5g0074971 RchiOBHm_Chr6g0262791 RchiOBHm_Chr6g0272021 RchiOBHm_Chr7g0181271 RchiOBHm_Chr7g0224511 RchiOBHm_Chr7g0225251
rosa_laevigata RLG00000017287
rosa_multiflora Rmu_co8215414.1_g000001 Rmu_sc0001850.1_g000028 Rmu_sc0002132.1_g000045 Rmu_sc0003623.1_g000032 Rmu_sc0003826.1_g000010 Rmu_sc0004165.1_g000032 Rmu_sc0004805.1_g000052 Rmu_sc0005837.1_g000007 Rmu_sc0011261.1_g000003 Rmu_sc0012066.1_g000001 Rmu_sc0021240.1_g000002 Rmu_sc0028377.1_g000003 Rmu_ssc0000454.1_g000003
rosa_roxburghii Rroxscaffold_177G00434230 Rroxscaffold_180G00433210 Rroxscaffold_1G00050960 Rroxscaffold_2G00112540 Rroxscaffold_7G00172420
rosa_rugosa Rorug02G0446000 Rorug03G0370600 Rorug04G0217600.1 Rorug07G0160200 Rorug07G0292300.1
rosa_samantha Rh3AG161100 Rh5AG403600 Rh5CG315600 Rh5CG315800 Rh6BG408500 Rh7CG313500
rosa_wichuraiana Rw4G023910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 431
AgsI TTSAA 1 cut(s) 73
AjnI CCWGG 1 cut(s) 37
AluBI AGCT 1 cut(s) 401
AluI AGCT 1 cut(s) 401
BccI CCATC 2 cut(s) 146, 306
BciT130I CCWGG 1 cut(s) 39
BfaI CTAG 4 cut(s) 159, 308, 341, 442
BfrI CTTAAG 1 cut(s) 431
Bme1390I CCNGG 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 39
Bpu10I CCTNAGC 1 cut(s) 126
BpuEI CTTGAG 1 cut(s) 217
BsaJI CCNNGG 2 cut(s) 38, 241
Bse1I ACTGG 2 cut(s) 87, 214
Bse3DI GCAATG 1 cut(s) 292
BseBI CCWGG 1 cut(s) 39
BseDI CCNNGG 2 cut(s) 38, 241
BseGI GGATG 1 cut(s) 364
BseMI GCAATG 1 cut(s) 292
BseMII CTCAG 1 cut(s) 117
BseNI ACTGG 2 cut(s) 87, 214
BslFI GGGAC 1 cut(s) 282
BsmFI GGGAC 1 cut(s) 282
Bsp143I GATC 1 cut(s) 427
BspCNI CTCAG 1 cut(s) 118
BspTI CTTAAG 1 cut(s) 431
BsrDI GCAATG 1 cut(s) 292
BsrI ACTGG 2 cut(s) 87, 214
BssECI CCNNGG 2 cut(s) 38, 241
BssMI GATC 1 cut(s) 427
BssT1I CCWWGG 1 cut(s) 241
Bst2UI CCWGG 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 84
BstAFI CTTAAG 1 cut(s) 431
BstDEI CTNAG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 364
BstKTI GATC 1 cut(s) 430
BstMBI GATC 1 cut(s) 427
BstNI CCWGG 1 cut(s) 39
BstNSI RCATGY 1 cut(s) 440
BstSCI CCNGG 1 cut(s) 37
BtsCI GGATG 1 cut(s) 364
BtsIMutI CAGTG 1 cut(s) 207
CviAII CATG 2 cut(s) 326, 437
CviJI RGCY 3 cut(s) 76, 281, 401
CviKI_1 RGCY 3 cut(s) 76, 281, 401
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 429
DpnII GATC 1 cut(s) 427
DraI TTTAAA 1 cut(s) 139
Eco130I CCWWGG 1 cut(s) 241
EcoRII CCWGG 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 241
ErhI CCWWGG 1 cut(s) 241
FaeI CATG 2 cut(s) 329, 440
FaiI YATR 5 cut(s) 53, 234, 327, 426, 438
FaqI GGGAC 1 cut(s) 282
FatI CATG 2 cut(s) 325, 436
FokI GGATG 1 cut(s) 371
FspBI CTAG 4 cut(s) 159, 308, 341, 442
Hin1II CATG 2 cut(s) 329, 440
HinfI GANTC 2 cut(s) 56, 320
Hpy188III TCNNGA 1 cut(s) 196
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 367, 418
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 2 cut(s) 329, 440
Kzo9I GATC 1 cut(s) 427
LpnPI CCDG 7 cut(s) 24, 51, 100, 138, 171, 195, 210
MaeI CTAG 4 cut(s) 159, 308, 341, 442
MaeIII GTNAC 1 cut(s) 131
MalI GATC 1 cut(s) 429
MboI GATC 1 cut(s) 427
MboII GAAGA 3 cut(s) 87, 127, 296
MfeI CAATTG 1 cut(s) 413
MluCI AATT 3 cut(s) 140, 177, 413
MlyI GAGTC 1 cut(s) 50
MnlI CCTC 2 cut(s) 7, 87
MseI TTAA 6 cut(s) 33, 138, 143, 168, 374, 432
MslI CAYNNNNRTG 1 cut(s) 423
MspCI CTTAAG 1 cut(s) 431
MspR9I CCNGG 1 cut(s) 39
MunI CAATTG 1 cut(s) 413
MvaI CCWGG 1 cut(s) 39
NdeII GATC 1 cut(s) 427
NlaIII CATG 2 cut(s) 329, 440
NspI RCATGY 1 cut(s) 440
PfeI GAWTC 1 cut(s) 320
PleI GAGTC 1 cut(s) 50
PpsI GAGTC 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
RseI CAYNNNNRTG 1 cut(s) 423
SaqAI TTAA 6 cut(s) 33, 138, 143, 168, 374, 432
Sau3AI GATC 1 cut(s) 427
SchI GAGTC 1 cut(s) 50
ScrFI CCNGG 1 cut(s) 39
SetI ASST 3 cut(s) 243, 355, 403
SmiMI CAYNNNNRTG 1 cut(s) 423
SmlI CTYRAG 2 cut(s) 196, 431
SmoI CTYRAG 2 cut(s) 196, 431
Sse9I AATT 3 cut(s) 140, 177, 413
SspMI CTAG 4 cut(s) 159, 308, 341, 442
StyD4I CCNGG 1 cut(s) 37
StyI CCWWGG 1 cut(s) 241
TaaI ACNGT 1 cut(s) 84
TasI AATT 3 cut(s) 140, 177, 413
TfiI GAWTC 1 cut(s) 320
Tru1I TTAA 6 cut(s) 33, 138, 143, 168, 374, 432
Tru9I TTAA 6 cut(s) 33, 138, 143, 168, 374, 432
TscAI CASTG 1 cut(s) 214
TspRI CASTG 1 cut(s) 214
Vha464I CTTAAG 1 cut(s) 431
XceI RCATGY 1 cut(s) 440
XspI CTAG 4 cut(s) 159, 308, 341, 442
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.