RchiOBHm_Chr4g0426191

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000890
Physical Location & Seq
Reverse (-)
51739697 .. 51740152
456 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39526

Sequence Viewer

Length: 456 bp
ATGGGTAAAATTGGGGCAGGTGGTGTAATTAGGAGTCATGATGGCTCTTGGGTTGCTGGATTTTATGCCAACCTGGGAAGTGGCTCTGTTCTCCAATCTGAGGCATGGGGTCTGTTGTTGGGGCTAAAATTGGCCTATGATAATCAATGCTCCCATTTGTATGTTGAAAGTGATTCTGAAACCCTTATTAACATGGTAAAGAATGGAGTGGATGAAGTGCATCCTCTAAAGACCATCCTCAATTGTTGCTCATTCTTGCAGCAAAAGTTCCTGAGCTTTGATATTAGACACACCTATAGAGAAGTGAATGTAGTTGCAGATATCCTATCCAAGGATGGGTTGCAGGCTGAAGCTGGGGTGCATGTCATGTTGCATCCTCCTCCACAAGTCATTAACTCTCTTCTTGATGACTTGTGTGAATTTCCTAGAGTTAGGATCGTGAATTCCGAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

151

Amino Acids

16.58

Weight (kDa)

5.39

Isoelectric Point (pI)

33.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 5 - 112 6e-23 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000890)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G42905
fragaria_vesca FvH4_1g15070 FvH4_1g21661 FvH4_1g24182 FvH4_2g15861 FvH4_7g26563
prunus_persica Prupe.1G097800_v2.0.a1 Prupe.1G446500_v2.0.a1 Prupe.4G161900_v2.0.a1 Prupe.5G085900_v2.0.a1 Prupe.6G118100_v2.0.a1 Prupe.6G201000_v2.0.a1 Prupe.7G199700_v2.0.a1
pyrus_communis pycom07g22740 pycom15g37390 pycom420g00480 pycom420g00490
rosa_chinensis RchiOBHm_Chr1g0319821 RchiOBHm_Chr1g0331331 RchiOBHm_Chr2g0144631 RchiOBHm_Chr2g0146161 RchiOBHm_Chr2g0152401 RchiOBHm_Chr3g0484381 RchiOBHm_Chr3g0484471 RchiOBHm_Chr3g0494391 RchiOBHm_Chr4g0411801 RchiOBHm_Chr4g0426191 RchiOBHm_Chr5g0016411 RchiOBHm_Chr5g0074971 RchiOBHm_Chr6g0262791 RchiOBHm_Chr6g0272021 RchiOBHm_Chr7g0181271 RchiOBHm_Chr7g0224511 RchiOBHm_Chr7g0225251
rosa_laevigata RLG00000017287
rosa_multiflora Rmu_co8215414.1_g000001 Rmu_sc0001850.1_g000028 Rmu_sc0002132.1_g000045 Rmu_sc0003623.1_g000032 Rmu_sc0003826.1_g000010 Rmu_sc0004165.1_g000032 Rmu_sc0004805.1_g000052 Rmu_sc0005837.1_g000007 Rmu_sc0011261.1_g000003 Rmu_sc0012066.1_g000001 Rmu_sc0021240.1_g000002 Rmu_sc0028377.1_g000003 Rmu_ssc0000454.1_g000003
rosa_roxburghii Rroxscaffold_177G00434230 Rroxscaffold_180G00433210 Rroxscaffold_1G00050960 Rroxscaffold_2G00112540 Rroxscaffold_7G00172420
rosa_rugosa Rorug02G0446000 Rorug03G0370600 Rorug04G0217600.1 Rorug07G0160200 Rorug07G0292300.1
rosa_samantha Rh3AG161100 Rh5AG403600 Rh5CG315600 Rh5CG315800 Rh6BG408500 Rh7CG313500
rosa_wichuraiana Rw4G023910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 8
Acc36I ACCTGC 1 cut(s) 8
AclWI GGATC 1 cut(s) 443
AcsI RAATTY 2 cut(s) 419, 442
AcuI CTGAAG 1 cut(s) 369
AfiI CCNNNNNNNGG 3 cut(s) 100, 331, 336
AgsI TTSAA 1 cut(s) 167
AjnI CCWGG 1 cut(s) 72
AluBI AGCT 2 cut(s) 276, 353
AluI AGCT 2 cut(s) 276, 353
AlwI GGATC 1 cut(s) 443
AoxI GGCC 1 cut(s) 132
ApeKI GCWGC 1 cut(s) 259
ApoI RAATTY 2 cut(s) 419, 442
BbvI GCAGC 1 cut(s) 271
BccI CCATC 3 cut(s) 35, 242, 329
BciT130I CCWGG 1 cut(s) 74
BfaI CTAG 1 cut(s) 426
BfmI CTRYAG 1 cut(s) 295
BfuAI ACCTGC 1 cut(s) 8
BisI GCNGC 1 cut(s) 260
BlsI GCNGC 1 cut(s) 261
Bme1390I CCNGG 1 cut(s) 74
BmrFI CCNGG 1 cut(s) 74
BmsI GCATC 2 cut(s) 229, 382
Bpu10I CCTNAGC 1 cut(s) 272
BsaJI CCNNGG 2 cut(s) 73, 330
Bsc4I CCNNNNNNNGG 3 cut(s) 100, 331, 336
BseBI CCWGG 1 cut(s) 74
BseDI CCNNGG 2 cut(s) 73, 330
BseGI GGATG 5 cut(s) 217, 220, 234, 340, 373
BseLI CCNNNNNNNGG 3 cut(s) 100, 331, 336
BseMII CTCAG 2 cut(s) 90, 263
BseRI GAGGAG 1 cut(s) 369
BseXI GCAGC 1 cut(s) 271
BseYI CCCAGC 1 cut(s) 353
BshFI GGCC 1 cut(s) 134
BslI CCNNNNNNNGG 3 cut(s) 100, 331, 336
BsnI GGCC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 435
BspANI GGCC 1 cut(s) 134
BspCNI CTCAG 2 cut(s) 91, 264
BspHI TCATGA 1 cut(s) 37
BspMI ACCTGC 1 cut(s) 8
BspPI GGATC 1 cut(s) 443
BssECI CCNNGG 2 cut(s) 73, 330
BssMI GATC 1 cut(s) 435
BssT1I CCWWGG 1 cut(s) 330
Bst2UI CCWGG 1 cut(s) 74
Bst6I CTCTTC 1 cut(s) 405
BstC8I GCNNGC 1 cut(s) 345
BstDEI CTNAG 2 cut(s) 99, 272
BstENI CCTNNNNNAGG 1 cut(s) 329
BstF5I GGATG 5 cut(s) 217, 220, 234, 340, 373
BstKTI GATC 1 cut(s) 438
BstMBI GATC 1 cut(s) 435
BstNI CCWGG 1 cut(s) 74
BstNSI RCATGY 1 cut(s) 365
BstSCI CCNGG 1 cut(s) 72
BstSFI CTRYAG 1 cut(s) 295
BstV1I GCAGC 1 cut(s) 271
BsuRI GGCC 1 cut(s) 134
BtsCI GGATG 5 cut(s) 217, 220, 234, 340, 373
BveI ACCTGC 1 cut(s) 8
Cac8I GCNNGC 1 cut(s) 345
CciI TCATGA 1 cut(s) 37
CviAII CATG 5 cut(s) 38, 105, 193, 362, 367
CviJI RGCY 7 cut(s) 45, 84, 124, 134, 276, 347, 353
CviKI_1 RGCY 7 cut(s) 45, 84, 124, 134, 276, 347, 353
DdeI CTNAG 2 cut(s) 99, 272
DpnI GATC 1 cut(s) 437
DpnII GATC 1 cut(s) 435
Eam1104I CTCTTC 1 cut(s) 405
EarI CTCTTC 1 cut(s) 405
Eco130I CCWWGG 1 cut(s) 330
Eco32I GATATC 1 cut(s) 322
Eco57I CTGAAG 1 cut(s) 369
EcoNI CCTNNNNNAGG 1 cut(s) 329
EcoRI GAATTC 1 cut(s) 442
EcoRII CCWGG 1 cut(s) 72
EcoRV GATATC 1 cut(s) 322
EcoT14I CCWWGG 1 cut(s) 330
ErhI CCWWGG 1 cut(s) 330
FaeI CATG 5 cut(s) 41, 108, 196, 365, 370
FaiI YATR 9 cut(s) 39, 66, 106, 138, 162, 194, 297, 363, 368
FatI CATG 5 cut(s) 37, 104, 192, 361, 366
Fnu4HI GCNGC 1 cut(s) 260
FokI GGATG 5 cut(s) 207, 221, 224, 347, 360
Fsp4HI GCNGC 1 cut(s) 260
FspBI CTAG 1 cut(s) 426
GluI GCNGC 1 cut(s) 260
GsaI CCCAGC 1 cut(s) 357
HaeIII GGCC 1 cut(s) 134
Hin1II CATG 5 cut(s) 41, 108, 196, 365, 370
HinfI GANTC 2 cut(s) 34, 173
Hpy188I TCNGA 3 cut(s) 100, 178, 448
Hpy188III TCNNGA 4 cut(s) 38, 271, 404, 439
HpyCH4V TGCA 6 cut(s) 220, 259, 317, 343, 361, 373
HpyF3I CTNAG 2 cut(s) 99, 272
Hsp92II CATG 5 cut(s) 41, 108, 196, 365, 370
Kzo9I GATC 1 cut(s) 435
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 7 cut(s) 3, 42, 59, 86, 284, 329, 339
Lsp1109I GCAGC 1 cut(s) 271
LweI GCATC 2 cut(s) 229, 382
MaeI CTAG 1 cut(s) 426
MalI GATC 1 cut(s) 437
MboI GATC 1 cut(s) 435
MboII GAAGA 1 cut(s) 392
MfeI CAATTG 1 cut(s) 241
MluCI AATT 6 cut(s) 9, 27, 128, 241, 419, 442
MlyI GAGTC 1 cut(s) 43
MnlI CCTC 5 cut(s) 94, 234, 248, 387, 390
MseI TTAA 2 cut(s) 189, 393
MslI CAYNNNNRTG 1 cut(s) 159
MspR9I CCNGG 1 cut(s) 74
MunI CAATTG 1 cut(s) 241
MvaI CCWGG 1 cut(s) 74
NdeII GATC 1 cut(s) 435
NlaIII CATG 5 cut(s) 41, 108, 196, 365, 370
NspI RCATGY 1 cut(s) 365
PagI TCATGA 1 cut(s) 37
PaqCI CACCTGC 1 cut(s) 8
PcsI WCGNNNNNNNCGW 1 cut(s) 444
PfeI GAWTC 1 cut(s) 173
PkrI GCNGC 1 cut(s) 261
PleI GAGTC 1 cut(s) 42
PpsI GAGTC 1 cut(s) 42
Psp6I CCWGG 1 cut(s) 72
PspFI CCCAGC 1 cut(s) 353
PspGI CCWGG 1 cut(s) 72
RseI CAYNNNNRTG 1 cut(s) 159
SaqAI TTAA 2 cut(s) 189, 393
SatI GCNGC 1 cut(s) 260
Sau3AI GATC 1 cut(s) 435
SchI GAGTC 1 cut(s) 43
ScrFI CCNGG 1 cut(s) 74
SetI ASST 5 cut(s) 22, 75, 278, 296, 355
SfaNI GCATC 2 cut(s) 229, 382
SfcI CTRYAG 1 cut(s) 295
SmiMI CAYNNNNRTG 1 cut(s) 159
Sse9I AATT 6 cut(s) 9, 27, 128, 241, 419, 442
SspMI CTAG 1 cut(s) 426
StyD4I CCNGG 1 cut(s) 72
StyI CCWWGG 1 cut(s) 330
TasI AATT 6 cut(s) 9, 27, 128, 241, 419, 442
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 2 cut(s) 189, 393
Tru9I TTAA 2 cut(s) 189, 393
TseI GCWGC 1 cut(s) 259
TspDTI ATGAA 1 cut(s) 228
XagI CCTNNNNNAGG 1 cut(s) 329
XapI RAATTY 2 cut(s) 419, 442
XceI RCATGY 1 cut(s) 365
XspI CTAG 1 cut(s) 426
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.