Prupe.7G199700_v2.0.a1

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0000890
Physical Location & Seq
Reverse (-)
18697834 .. 18698388
555 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G199700.1

Sequence Viewer

Length: 555 bp
ATGAATTTTCTTTCCTTTTCTATTTTTGTAAAATGGGAATTACGTGTGGAGAAGGTAAATGTGAAAGGAAAGTTGAACTTAAAAGAGCCTCTTCGGTTCTCTGGCAACCTTCCTTGGACACTTGTTTTTACGGCCTCTATTTGGCATTGTTGGAAATGGAGATGCAACTCTATTTTTAACCCTGGCTACGAGCCTCCTACCAACCCCCATCACACTATTCTGCAATTTTCTAGTGAATGGCTTGATGCCAATAATGTGGTTAATGCTAAGCCTACTAGAGAGGTCATCCAAGTCCATTGGAGTAGTCCTCCTACTCTTGGCAACTTCAAATTGAATGCGGATGGCTCTTGTAAAACAGATTCTTGGAAGATATGTGCTGGTGGTTTGCTAAGGGACTCTAATGGAGCTTGGATCTGTGGGTTCTCTGCCAATATTGGGATTGGAAATATTAATGAGGCTGAACTATGGAGGCTCTTTAGACGTTTGCATATGGCTTGGGCCATGGGCATTAGGTCCTTGATATTGAATGTGATTTCTTGTCTGTTGTCTCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

185

Amino Acids

20.99

Weight (kDa)

9.32

Isoelectric Point (pI)

34.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000890)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G42905
fragaria_vesca FvH4_1g15070 FvH4_1g21661 FvH4_1g24182 FvH4_2g15861 FvH4_7g26563
prunus_persica Prupe.1G097800_v2.0.a1 Prupe.1G446500_v2.0.a1 Prupe.4G161900_v2.0.a1 Prupe.5G085900_v2.0.a1 Prupe.6G118100_v2.0.a1 Prupe.6G201000_v2.0.a1 Prupe.7G199700_v2.0.a1
pyrus_communis pycom07g22740 pycom15g37390 pycom420g00480 pycom420g00490
rosa_chinensis RchiOBHm_Chr1g0319821 RchiOBHm_Chr1g0331331 RchiOBHm_Chr2g0144631 RchiOBHm_Chr2g0146161 RchiOBHm_Chr2g0152401 RchiOBHm_Chr3g0484381 RchiOBHm_Chr3g0484471 RchiOBHm_Chr3g0494391 RchiOBHm_Chr4g0411801 RchiOBHm_Chr4g0426191 RchiOBHm_Chr5g0016411 RchiOBHm_Chr5g0074971 RchiOBHm_Chr6g0262791 RchiOBHm_Chr6g0272021 RchiOBHm_Chr7g0181271 RchiOBHm_Chr7g0224511 RchiOBHm_Chr7g0225251
rosa_laevigata RLG00000017287
rosa_multiflora Rmu_co8215414.1_g000001 Rmu_sc0001850.1_g000028 Rmu_sc0002132.1_g000045 Rmu_sc0003623.1_g000032 Rmu_sc0003826.1_g000010 Rmu_sc0004165.1_g000032 Rmu_sc0004805.1_g000052 Rmu_sc0005837.1_g000007 Rmu_sc0011261.1_g000003 Rmu_sc0012066.1_g000001 Rmu_sc0021240.1_g000002 Rmu_sc0028377.1_g000003 Rmu_ssc0000454.1_g000003
rosa_roxburghii Rroxscaffold_177G00434230 Rroxscaffold_180G00433210 Rroxscaffold_1G00050960 Rroxscaffold_2G00112540 Rroxscaffold_7G00172420
rosa_rugosa Rorug02G0446000 Rorug03G0370600 Rorug04G0217600.1 Rorug07G0160200 Rorug07G0292300.1
rosa_samantha Rh3AG161100 Rh5AG403600 Rh5CG315600 Rh5CG315800 Rh6BG408500 Rh7CG313500
rosa_wichuraiana Rw4G023910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 338
AclWI GGATC 1 cut(s) 419
AcsI RAATTY 1 cut(s) 4
AfiI CCNNNNNNNGG 3 cut(s) 141, 317, 435
AflIII ACRYGT 1 cut(s) 43
AgsI TTSAA 4 cut(s) 76, 328, 334, 526
AjnI CCWGG 1 cut(s) 181
AluBI AGCT 1 cut(s) 407
AluI AGCT 1 cut(s) 407
AlwI GGATC 1 cut(s) 419
AoxI GGCC 2 cut(s) 132, 498
ApoI RAATTY 1 cut(s) 4
AseI ATTAAT 1 cut(s) 450
AspS9I GGNCC 2 cut(s) 498, 513
AvaII GGWCC 1 cut(s) 513
BccI CCATC 2 cut(s) 216, 335
BceAI ACGGC 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 183
BfaI CTAG 2 cut(s) 231, 276
BlpI GCTNAGC 1 cut(s) 267
Bme1390I CCNGG 1 cut(s) 183
Bme18I GGWCC 1 cut(s) 513
BmgT120I GGNCC 2 cut(s) 498, 513
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 2 cut(s) 152, 235
BplI GAGNNNNNCTC 2 cut(s) 292, 324
Bpu10I CCTNAGC 1 cut(s) 389
Bpu1102I GCTNAGC 1 cut(s) 267
BsaAI YACGTR 1 cut(s) 44
BsaJI CCNNGG 3 cut(s) 113, 181, 501
Bsc4I CCNNNNNNNGG 3 cut(s) 141, 317, 435
BseBI CCWGG 1 cut(s) 183
BseDI CCNNGG 3 cut(s) 113, 181, 501
BseGI GGATG 2 cut(s) 285, 346
BseLI CCNNNNNNNGG 3 cut(s) 141, 317, 435
BshFI GGCC 2 cut(s) 134, 500
BslFI GGGAC 1 cut(s) 407
BslI CCNNNNNNNGG 3 cut(s) 141, 317, 435
BsmFI GGGAC 1 cut(s) 407
BsmI GAATGC 1 cut(s) 340
BsnI GGCC 2 cut(s) 134, 500
Bsp143I GATC 1 cut(s) 411
Bsp1720I GCTNAGC 1 cut(s) 267
Bsp19I CCATGG 1 cut(s) 501
BspACI CCGC 1 cut(s) 338
BspANI GGCC 2 cut(s) 134, 500
BspPI GGATC 1 cut(s) 419
BssECI CCNNGG 3 cut(s) 113, 181, 501
BssMI GATC 1 cut(s) 411
BssT1I CCWWGG 2 cut(s) 113, 501
Bst2UI CCWGG 1 cut(s) 183
Bst6I CTCTTC 1 cut(s) 96
BstBAI YACGTR 1 cut(s) 44
BstDEI CTNAG 2 cut(s) 267, 389
BstDSI CCRYGG 1 cut(s) 501
BstF5I GGATG 2 cut(s) 285, 346
BstKTI GATC 1 cut(s) 414
BstMBI GATC 1 cut(s) 411
BstNI CCWGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 181
BstX2I RGATCY 1 cut(s) 411
BstXI CCANNNNNNTGG 1 cut(s) 256
BstYI RGATCY 1 cut(s) 411
BsuRI GGCC 2 cut(s) 134, 500
BtgI CCRYGG 1 cut(s) 501
BtsCI GGATG 2 cut(s) 285, 346
Cfr13I GGNCC 2 cut(s) 498, 513
CviAII CATG 1 cut(s) 502
DdeI CTNAG 2 cut(s) 267, 389
DpnI GATC 1 cut(s) 413
DpnII GATC 1 cut(s) 411
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco130I CCWWGG 2 cut(s) 113, 501
Eco47I GGWCC 1 cut(s) 513
EcoO109I RGGNCCY 1 cut(s) 513
EcoRII CCWGG 1 cut(s) 181
EcoT14I CCWWGG 2 cut(s) 113, 501
ErhI CCWWGG 2 cut(s) 113, 501
FaeI CATG 1 cut(s) 505
FaiI YATR 5 cut(s) 373, 466, 489, 491, 503
FalI AAGNNNNNCTT 4 cut(s) 62, 94, 75, 107
FaqI GGGAC 1 cut(s) 407
FatI CATG 1 cut(s) 501
FauNDI CATATG 1 cut(s) 489
FokI GGATG 2 cut(s) 272, 353
FspBI CTAG 2 cut(s) 231, 276
HaeIII GGCC 2 cut(s) 134, 500
Hin1II CATG 1 cut(s) 505
HinfI GANTC 2 cut(s) 359, 395
Hpy188I TCNGA 1 cut(s) 554
HpyAV CCTTC 2 cut(s) 46, 119
HpyCH4IV ACGT 2 cut(s) 43, 481
HpyCH4V TGCA 3 cut(s) 165, 223, 487
HpyF3I CTNAG 2 cut(s) 267, 389
HpySE526I ACGT 2 cut(s) 43, 481
Hsp92II CATG 1 cut(s) 505
Kzo9I GATC 1 cut(s) 411
LmnI GCTCC 1 cut(s) 404
LpnPI CCDG 4 cut(s) 87, 168, 195, 363
LweI GCATC 2 cut(s) 152, 235
MaeI CTAG 2 cut(s) 231, 276
MaeII ACGT 2 cut(s) 43, 481
MalI GATC 1 cut(s) 413
MboI GATC 1 cut(s) 411
MboII GAAGA 2 cut(s) 83, 379
MflI RGATCY 1 cut(s) 411
MluCI AATT 4 cut(s) 4, 38, 224, 329
MlyI GAGTC 1 cut(s) 389
MmeI TCCRAC 1 cut(s) 131
MnlI CCTC 7 cut(s) 99, 145, 204, 274, 318, 448, 462
MseI TTAA 4 cut(s) 80, 177, 261, 450
MspR9I CCNGG 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 340
MvaI CCWGG 1 cut(s) 183
NcoI CCATGG 1 cut(s) 501
NdeI CATATG 1 cut(s) 489
NdeII GATC 1 cut(s) 411
NlaIII CATG 1 cut(s) 505
PctI GAATGC 1 cut(s) 340
PfeI GAWTC 1 cut(s) 359
PleI GAGTC 1 cut(s) 389
PpsI GAGTC 1 cut(s) 389
Ppu21I YACGTR 1 cut(s) 44
PpuMI RGGWCCY 1 cut(s) 513
PshBI ATTAAT 1 cut(s) 450
Psp5II RGGWCCY 1 cut(s) 513
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PspPI GGNCC 2 cut(s) 498, 513
PspPPI RGGWCCY 1 cut(s) 513
PsuI RGATCY 1 cut(s) 411
SaqAI TTAA 4 cut(s) 80, 177, 261, 450
Sau3AI GATC 1 cut(s) 411
Sau96I GGNCC 2 cut(s) 498, 513
SchI GAGTC 1 cut(s) 389
ScrFI CCNGG 1 cut(s) 183
SetI ASST 7 cut(s) 46, 57, 111, 285, 409, 484, 515
SfaNI GCATC 2 cut(s) 152, 235
SinI GGWCC 1 cut(s) 513
Sse9I AATT 4 cut(s) 4, 38, 224, 329
SsiI CCGC 1 cut(s) 338
SspI AATATT 2 cut(s) 433, 448
SspMI CTAG 2 cut(s) 231, 276
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 2 cut(s) 113, 501
TaiI ACGT 2 cut(s) 46, 484
TasI AATT 4 cut(s) 4, 38, 224, 329
TfiI GAWTC 1 cut(s) 359
Tru1I TTAA 4 cut(s) 80, 177, 261, 450
Tru9I TTAA 4 cut(s) 80, 177, 261, 450
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 513
VspI ATTAAT 1 cut(s) 450
XapI RAATTY 1 cut(s) 4
XspI CTAG 2 cut(s) 231, 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.