Rroxscaffold_2G00112540

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000890
Physical Location & Seq
Reverse (-)
37722373 .. 37724723
2351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00112540.1

Sequence Viewer

Length: 171 bp
ATGCTTAATCAAGGGGTGGATGATCTTCATCCTTTGCATAATGTGATAAGTAGGTGCAAGTTTCTGCAGAATAAGCTCTCTACGTGTGAGGTCTCACTTGTGTTTAGAGAGATCAATATGGTGGCTGATATTCTCTCCAAGTCCAGATTGGGGTCTGAGTTTGGAGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

56

Amino Acids

6.3

Weight (kDa)

6.7

Isoelectric Point (pI)

33.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000890)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G42905
fragaria_vesca FvH4_1g15070 FvH4_1g21661 FvH4_1g24182 FvH4_2g15861 FvH4_7g26563
prunus_persica Prupe.1G097800_v2.0.a1 Prupe.1G446500_v2.0.a1 Prupe.4G161900_v2.0.a1 Prupe.5G085900_v2.0.a1 Prupe.6G118100_v2.0.a1 Prupe.6G201000_v2.0.a1 Prupe.7G199700_v2.0.a1
pyrus_communis pycom07g22740 pycom15g37390 pycom420g00480 pycom420g00490
rosa_chinensis RchiOBHm_Chr1g0319821 RchiOBHm_Chr1g0331331 RchiOBHm_Chr2g0144631 RchiOBHm_Chr2g0146161 RchiOBHm_Chr2g0152401 RchiOBHm_Chr3g0484381 RchiOBHm_Chr3g0484471 RchiOBHm_Chr3g0494391 RchiOBHm_Chr4g0411801 RchiOBHm_Chr4g0426191 RchiOBHm_Chr5g0016411 RchiOBHm_Chr5g0074971 RchiOBHm_Chr6g0262791 RchiOBHm_Chr6g0272021 RchiOBHm_Chr7g0181271 RchiOBHm_Chr7g0224511 RchiOBHm_Chr7g0225251
rosa_laevigata RLG00000017287
rosa_multiflora Rmu_co8215414.1_g000001 Rmu_sc0001850.1_g000028 Rmu_sc0002132.1_g000045 Rmu_sc0003623.1_g000032 Rmu_sc0003826.1_g000010 Rmu_sc0004165.1_g000032 Rmu_sc0004805.1_g000052 Rmu_sc0005837.1_g000007 Rmu_sc0011261.1_g000003 Rmu_sc0012066.1_g000001 Rmu_sc0021240.1_g000002 Rmu_sc0028377.1_g000003 Rmu_ssc0000454.1_g000003
rosa_roxburghii Rroxscaffold_177G00434230 Rroxscaffold_180G00433210 Rroxscaffold_1G00050960 Rroxscaffold_2G00112540 Rroxscaffold_7G00172420
rosa_rugosa Rorug02G0446000 Rorug03G0370600 Rorug04G0217600.1 Rorug07G0160200 Rorug07G0292300.1
rosa_samantha Rh3AG161100 Rh5AG403600 Rh5CG315600 Rh5CG315800 Rh6BG408500 Rh7CG313500
rosa_wichuraiana Rw4G023910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 150
AflIII ACRYGT 1 cut(s) 83
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw26I GTCTC 1 cut(s) 97
BcoDI GTCTC 1 cut(s) 97
BfmI CTRYAG 1 cut(s) 65
BsaAI YACGTR 1 cut(s) 84
BsaBI GATNNNNATC 1 cut(s) 27
BsaI GGTCTC 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 150
Bse8I GATNNNNATC 1 cut(s) 27
BseGI GGATG 2 cut(s) 25, 28
BseJI GATNNNNATC 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 150
BsmAI GTCTC 1 cut(s) 97
Bso31I GGTCTC 1 cut(s) 97
Bsp143I GATC 2 cut(s) 22, 111
BspCNI CTCAG 1 cut(s) 148
BspMAI CTGCAG 1 cut(s) 69
BspTNI GGTCTC 1 cut(s) 97
BssMI GATC 2 cut(s) 22, 111
BstBAI YACGTR 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 2 cut(s) 25, 28
BstKTI GATC 2 cut(s) 25, 114
BstMAI GTCTC 1 cut(s) 97
BstMBI GATC 2 cut(s) 22, 111
BstMWI GCNNNNNNNGC 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 65
BtsCI GGATG 2 cut(s) 25, 28
CviJI RGCY 2 cut(s) 76, 125
CviKI_1 RGCY 2 cut(s) 76, 125
DdeI CTNAG 1 cut(s) 156
DpnI GATC 2 cut(s) 24, 113
DpnII GATC 2 cut(s) 22, 111
Eco31I GGTCTC 1 cut(s) 97
FaiI YATR 2 cut(s) 39, 119
FokI GGATG 2 cut(s) 15, 32
Hpy188I TCNGA 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 144
HpyCH4IV ACGT 1 cut(s) 83
HpyCH4V TGCA 3 cut(s) 37, 57, 67
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 156
HpySE526I ACGT 1 cut(s) 83
Kzo9I GATC 2 cut(s) 22, 111
LpnPI CCDG 1 cut(s) 157
MaeII ACGT 1 cut(s) 83
MalI GATC 2 cut(s) 24, 113
MboI GATC 2 cut(s) 22, 111
MboII GAAGA 1 cut(s) 17
MnlI CCTC 1 cut(s) 82
MseI TTAA 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 73
NdeII GATC 2 cut(s) 22, 111
Ppu21I YACGTR 1 cut(s) 84
PstI CTGCAG 1 cut(s) 69
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 2 cut(s) 22, 111
SetI ASST 4 cut(s) 56, 78, 86, 93
SfcI CTRYAG 1 cut(s) 65
SgeI CNNG 6 cut(s) 23, 70, 96, 110, 151, 156
TaiI ACGT 1 cut(s) 86
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TspDTI ATGAA 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.