pycom420g00490

acid phosphatase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
Physical Location & Seq
Forward (+)
565719 .. 580396
14678 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom420g00490.1

Sequence Viewer

Length: 312 bp
ATGAGGGGATGCAGGGATGTAATCCTTGAATGTGATTCTTGGGATGCTGTTATTTTGATCCAAAAACCTATTTTGGATTCGCACCCGCTCTACAACCTCATTATTGACTGCAAAGAAGCCATCGGAAAAAATTGGAGATGTGAAGTCACTCATATCTATAGAGAAATGAATGCCTCAGCTGATCACATGGCTGACTTGGGTCATGGGCTATCTCTTGGCCTTCATGTTTTTGTTTCTCCTCCTACCACTGCTAGTAATTGTCTAGTTTCTGACTCTATTGGCAAGGCCCTCCCTAGGGCTGTTCTTGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.31

Weight (kDa)

5.87

Isoelectric Point (pI)

31.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 65 7.1e-09 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 88
AciI CCGC 1 cut(s) 86
AclWI GGATC 1 cut(s) 52
AfiI CCNNNNNNNGG 2 cut(s) 294, 295
AgsI TTSAA 1 cut(s) 29
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
AlwI GGATC 1 cut(s) 52
AoxI GGCC 2 cut(s) 217, 285
AspA2I CCTAGG 1 cut(s) 293
AspS9I GGNCC 1 cut(s) 286
AvrII CCTAGG 1 cut(s) 293
BbvCI CCTCAGC 1 cut(s) 175
BccI CCATC 1 cut(s) 128
BclI TGATCA 1 cut(s) 181
BfaI CTAG 3 cut(s) 252, 263, 294
BfmI CTRYAG 1 cut(s) 157
BlnI CCTAGG 1 cut(s) 293
BmgT120I GGNCC 1 cut(s) 286
BmsI GCATC 1 cut(s) 34
BoxI GACNNNNGTC 1 cut(s) 198
Bpu10I CCTNAGC 1 cut(s) 175
BsaJI CCNNGG 1 cut(s) 293
Bsc4I CCNNNNNNNGG 2 cut(s) 294, 295
BseDI CCNNGG 1 cut(s) 293
BseGI GGATG 3 cut(s) 14, 22, 49
BseLI CCNNNNNNNGG 2 cut(s) 294, 295
BseMII CTCAG 1 cut(s) 189
BseRI GAGGAG 1 cut(s) 228
BshFI GGCC 2 cut(s) 219, 287
BslI CCNNNNNNNGG 2 cut(s) 294, 295
BsmI GAATGC 1 cut(s) 175
BsnI GGCC 2 cut(s) 219, 287
Bsp143I GATC 2 cut(s) 57, 181
BspACI CCGC 1 cut(s) 86
BspANI GGCC 2 cut(s) 219, 287
BspCNI CTCAG 1 cut(s) 188
BspPI GGATC 1 cut(s) 52
BsrBI CCGCTC 1 cut(s) 88
BssECI CCNNGG 1 cut(s) 293
BssMI GATC 2 cut(s) 57, 181
BssT1I CCWWGG 1 cut(s) 293
BstDEI CTNAG 1 cut(s) 175
BstF5I GGATG 3 cut(s) 14, 22, 49
BstKTI GATC 2 cut(s) 60, 184
BstMBI GATC 2 cut(s) 57, 181
BstMWI GCNNNNNNNGC 1 cut(s) 305
BstPAI GACNNNNGTC 1 cut(s) 198
BstSFI CTRYAG 1 cut(s) 157
BsuRI GGCC 2 cut(s) 219, 287
BtsCI GGATG 3 cut(s) 14, 22, 49
BtsI GCAGTG 1 cut(s) 246
BtsIMutI CAGTG 1 cut(s) 246
Cfr13I GGNCC 1 cut(s) 286
CviAII CATG 3 cut(s) 187, 203, 224
CviJI RGCY 7 cut(s) 119, 179, 191, 208, 219, 287, 299
CviKI_1 RGCY 7 cut(s) 119, 179, 191, 208, 219, 287, 299
DdeI CTNAG 1 cut(s) 175
DpnI GATC 2 cut(s) 59, 183
DpnII GATC 2 cut(s) 57, 181
Eco130I CCWWGG 1 cut(s) 293
EcoO109I RGGNCCY 1 cut(s) 286
EcoT14I CCWWGG 1 cut(s) 293
ErhI CCWWGG 1 cut(s) 293
FaeI CATG 3 cut(s) 190, 206, 227
FaiI YATR 5 cut(s) 153, 159, 188, 204, 225
FatI CATG 3 cut(s) 186, 202, 223
FauI CCCGC 1 cut(s) 93
FbaI TGATCA 1 cut(s) 181
FokI GGATG 3 cut(s) 21, 29, 56
FspBI CTAG 3 cut(s) 252, 263, 294
HaeIII GGCC 2 cut(s) 219, 287
Hin1II CATG 3 cut(s) 190, 206, 227
HinfI GANTC 3 cut(s) 35, 77, 272
Hpy188I TCNGA 2 cut(s) 125, 271
HpyAV CCTTC 1 cut(s) 230
HpyCH4V TGCA 2 cut(s) 12, 111
HpyF10VI GCNNNNNNNGC 1 cut(s) 305
HpyF3I CTNAG 1 cut(s) 175
Hsp92II CATG 3 cut(s) 190, 206, 227
Ksp22I TGATCA 1 cut(s) 181
Kzo9I GATC 2 cut(s) 57, 181
LweI GCATC 1 cut(s) 34
MaeI CTAG 3 cut(s) 252, 263, 294
MaeIII GTNAC 1 cut(s) 145
MalI GATC 2 cut(s) 59, 183
MbiI CCGCTC 1 cut(s) 88
MboI GATC 2 cut(s) 57, 181
MluCI AATT 2 cut(s) 130, 256
MlyI GAGTC 1 cut(s) 266
MnlI CCTC 4 cut(s) 107, 184, 249, 299
MspA1I CMGCKG 1 cut(s) 179
Mva1269I GAATGC 1 cut(s) 175
MwoI GCNNNNNNNGC 1 cut(s) 305
NdeII GATC 2 cut(s) 57, 181
NlaIII CATG 3 cut(s) 190, 206, 227
NmuCI GTSAC 1 cut(s) 145
PctI GAATGC 1 cut(s) 175
PfeI GAWTC 2 cut(s) 35, 77
PleI GAGTC 1 cut(s) 266
PpsI GAGTC 1 cut(s) 266
PshAI GACNNNNGTC 1 cut(s) 198
PspPI GGNCC 1 cut(s) 286
PvuII CAGCTG 1 cut(s) 179
Sau3AI GATC 2 cut(s) 57, 181
Sau96I GGNCC 1 cut(s) 286
SchI GAGTC 1 cut(s) 266
SetI ASST 3 cut(s) 70, 99, 181
SfaNI GCATC 1 cut(s) 34
SfcI CTRYAG 1 cut(s) 157
Sse9I AATT 2 cut(s) 130, 256
SsiI CCGC 1 cut(s) 86
SspMI CTAG 3 cut(s) 252, 263, 294
StyI CCWWGG 1 cut(s) 293
TasI AATT 2 cut(s) 130, 256
TfiI GAWTC 2 cut(s) 35, 77
TscAI CASTG 1 cut(s) 253
TseFI GTSAC 1 cut(s) 145
Tsp45I GTSAC 1 cut(s) 145
TspDTI ATGAA 2 cut(s) 182, 212
TspRI CASTG 1 cut(s) 253
XmaJI CCTAGG 1 cut(s) 293
XspI CTAG 3 cut(s) 252, 263, 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.