RchiOBHm_Chr7g0225251

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0000890
Physical Location & Seq
Forward (+)
47797107 .. 47797704
598 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20174

Sequence Viewer

Length: 570 bp
ATGTCTGCAAATGATACTATTACAAGGAAATCCAAGAAAACTATTATTGGTATGTTTTGGATTAAGCCCCCTACAGACTTTTACAAATTAAATGTTGATGGTGCTAGGCAACAAAATGGTAATATTGCTGCTGGTGGTGTGTTAAGGGATCACATAGGTTGGTGGATTTCTAGTTTCATCGCAAATTTAGGTTGTGGATCTGTTTTGCAGGCTGAAGCGTGGGGCTTATTGATTGGGTTAAAGATGGCTTCTGCCTCCCAATGCCATCATCTTTTGGTTGAGTGTGATTCTGAGGTCCTAGTGAGTCTAATCAATGATGGTGTGGATGAGTTACATCCTCTAAAAACGATCATTGATTGCTGCAATTCTTTGAGAAGACAGTTATGGAGTTGTGAGATAACACATGTTTATAGGGAAATTAACCAGGTTGATGATGTGCTTTCCAAGGCTGGTTTAGACACTGACATTGGAGTGCATTTCATGGAGCAACCTCCTCCACAAGTGATGCCTTCCTTTCTTGATGACTTGTGTGAAAGTCCTAGATTTAGGAATGTAGTTTCTGATATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

189

Amino Acids

21.05

Weight (kDa)

5.26

Isoelectric Point (pI)

46.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 31 - 150 9e-25 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000890)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G42905
fragaria_vesca FvH4_1g15070 FvH4_1g21661 FvH4_1g24182 FvH4_2g15861 FvH4_7g26563
prunus_persica Prupe.1G097800_v2.0.a1 Prupe.1G446500_v2.0.a1 Prupe.4G161900_v2.0.a1 Prupe.5G085900_v2.0.a1 Prupe.6G118100_v2.0.a1 Prupe.6G201000_v2.0.a1 Prupe.7G199700_v2.0.a1
pyrus_communis pycom07g22740 pycom15g37390 pycom420g00480 pycom420g00490
rosa_chinensis RchiOBHm_Chr1g0319821 RchiOBHm_Chr1g0331331 RchiOBHm_Chr2g0144631 RchiOBHm_Chr2g0146161 RchiOBHm_Chr2g0152401 RchiOBHm_Chr3g0484381 RchiOBHm_Chr3g0484471 RchiOBHm_Chr3g0494391 RchiOBHm_Chr4g0411801 RchiOBHm_Chr4g0426191 RchiOBHm_Chr5g0016411 RchiOBHm_Chr5g0074971 RchiOBHm_Chr6g0262791 RchiOBHm_Chr6g0272021 RchiOBHm_Chr7g0181271 RchiOBHm_Chr7g0224511 RchiOBHm_Chr7g0225251
rosa_laevigata RLG00000017287
rosa_multiflora Rmu_co8215414.1_g000001 Rmu_sc0001850.1_g000028 Rmu_sc0002132.1_g000045 Rmu_sc0003623.1_g000032 Rmu_sc0003826.1_g000010 Rmu_sc0004165.1_g000032 Rmu_sc0004805.1_g000052 Rmu_sc0005837.1_g000007 Rmu_sc0011261.1_g000003 Rmu_sc0012066.1_g000001 Rmu_sc0021240.1_g000002 Rmu_sc0028377.1_g000003 Rmu_ssc0000454.1_g000003
rosa_roxburghii Rroxscaffold_177G00434230 Rroxscaffold_180G00433210 Rroxscaffold_1G00050960 Rroxscaffold_2G00112540 Rroxscaffold_7G00172420
rosa_rugosa Rorug02G0446000 Rorug03G0370600 Rorug04G0217600.1 Rorug07G0160200 Rorug07G0292300.1
rosa_samantha Rh3AG161100 Rh5AG403600 Rh5CG315600 Rh5CG315800 Rh6BG408500 Rh7CG313500
rosa_wichuraiana Rw4G023910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 156, 205
AcsI RAATTY 1 cut(s) 184
AcuI CTGAAG 1 cut(s) 234
AflIII ACRYGT 1 cut(s) 403
AjnI CCWGG 1 cut(s) 423
AlwI GGATC 2 cut(s) 156, 205
ApeKI GCWGC 2 cut(s) 128, 360
ApoI RAATTY 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 295
AvaII GGWCC 1 cut(s) 295
BbsI GAAGAC 1 cut(s) 382
BbvI GCAGC 2 cut(s) 115, 347
BccI CCATC 4 cut(s) 92, 238, 273, 311
BciT130I CCWGG 1 cut(s) 425
BfaI CTAG 4 cut(s) 105, 171, 299, 540
BfmI CTRYAG 1 cut(s) 72
BisI GCNGC 2 cut(s) 129, 361
BlsI GCNGC 2 cut(s) 130, 362
Bme1390I CCNGG 1 cut(s) 425
Bme18I GGWCC 1 cut(s) 295
BmgT120I GGNCC 1 cut(s) 295
BmrFI CCNGG 1 cut(s) 425
BmsI GCATC 1 cut(s) 495
BpiI GAAGAC 1 cut(s) 382
BsaJI CCNNGG 1 cut(s) 444
BseBI CCWGG 1 cut(s) 425
BseDI CCNNGG 1 cut(s) 444
BseGI GGATG 2 cut(s) 331, 334
BseMII CTCAG 1 cut(s) 282
BseRI GAGGAG 1 cut(s) 483
BseXI GCAGC 2 cut(s) 115, 347
Bsp143I GATC 3 cut(s) 148, 197, 348
BspCNI CTCAG 1 cut(s) 283
BspPI GGATC 2 cut(s) 156, 205
BssECI CCNNGG 1 cut(s) 444
BssMI GATC 3 cut(s) 148, 197, 348
BssT1I CCWWGG 1 cut(s) 444
Bst2UI CCWGG 1 cut(s) 425
Bst4CI ACNGT 1 cut(s) 381
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 1 cut(s) 291
BstF5I GGATG 2 cut(s) 331, 334
BstKTI GATC 3 cut(s) 151, 200, 351
BstMBI GATC 3 cut(s) 148, 197, 348
BstNI CCWGG 1 cut(s) 425
BstNSI RCATGY 1 cut(s) 407
BstSCI CCNGG 1 cut(s) 423
BstSFI CTRYAG 1 cut(s) 72
BstV1I GCAGC 2 cut(s) 115, 347
BstV2I GAAGAC 1 cut(s) 382
BstX2I RGATCY 1 cut(s) 197
BstYI RGATCY 1 cut(s) 197
BtgZI GCGATG 1 cut(s) 163
BtsCI GGATG 2 cut(s) 331, 334
BtsIMutI CAGTG 1 cut(s) 459
Cac8I GCNNGC 1 cut(s) 210
Cfr13I GGNCC 1 cut(s) 295
CsiI ACCWGGT 1 cut(s) 423
CviAII CATG 2 cut(s) 404, 481
CviJI RGCY 5 cut(s) 67, 212, 225, 248, 449
CviKI_1 RGCY 5 cut(s) 67, 212, 225, 248, 449
DdeI CTNAG 1 cut(s) 291
DpnI GATC 3 cut(s) 150, 199, 350
DpnII GATC 3 cut(s) 148, 197, 348
Eco130I CCWWGG 1 cut(s) 444
Eco47I GGWCC 1 cut(s) 295
Eco57I CTGAAG 1 cut(s) 234
EcoO109I RGGNCCY 1 cut(s) 295
EcoRII CCWGG 1 cut(s) 423
EcoT14I CCWWGG 1 cut(s) 444
ErhI CCWWGG 1 cut(s) 444
FaeI CATG 2 cut(s) 407, 484
FaiI YATR 7 cut(s) 53, 155, 385, 405, 411, 482, 566
FatI CATG 2 cut(s) 403, 480
Fnu4HI GCNGC 2 cut(s) 129, 361
FokI GGATG 2 cut(s) 321, 338
Fsp4HI GCNGC 2 cut(s) 129, 361
FspBI CTAG 4 cut(s) 105, 171, 299, 540
GluI GCNGC 2 cut(s) 129, 361
Hin1II CATG 2 cut(s) 407, 484
HinfI GANTC 2 cut(s) 287, 304
Hpy188I TCNGA 2 cut(s) 292, 562
Hpy188III TCNNGA 1 cut(s) 518
HpyAV CCTTC 1 cut(s) 519
HpyCH4III ACNGT 1 cut(s) 381
HpyCH4V TGCA 4 cut(s) 8, 208, 363, 475
HpyF3I CTNAG 1 cut(s) 291
Hsp92II CATG 2 cut(s) 407, 484
Kzo9I GATC 3 cut(s) 148, 197, 348
LmnI GCTCC 1 cut(s) 484
LpnPI CCDG 5 cut(s) 117, 194, 410, 435, 437
Lsp1109I GCAGC 2 cut(s) 115, 347
LweI GCATC 1 cut(s) 495
MabI ACCWGGT 1 cut(s) 423
MaeI CTAG 4 cut(s) 105, 171, 299, 540
MaeIII GTNAC 1 cut(s) 330
MalI GATC 3 cut(s) 150, 199, 350
MboI GATC 3 cut(s) 148, 197, 348
MboII GAAGA 1 cut(s) 387
MflI RGATCY 1 cut(s) 197
MluCI AATT 4 cut(s) 86, 184, 364, 417
MlyI GAGTC 1 cut(s) 313
MnlI CCTC 5 cut(s) 265, 286, 348, 501, 504
MseI TTAA 5 cut(s) 63, 89, 143, 239, 420
MslI CAYNNNNRTG 1 cut(s) 470
MspR9I CCNGG 1 cut(s) 425
MvaI CCWGG 1 cut(s) 425
NdeII GATC 3 cut(s) 148, 197, 348
NlaIII CATG 2 cut(s) 407, 484
NspI RCATGY 1 cut(s) 407
PciI ACATGT 1 cut(s) 403
PfeI GAWTC 1 cut(s) 287
PkrI GCNGC 2 cut(s) 130, 362
PleI GAGTC 1 cut(s) 312
PpsI GAGTC 1 cut(s) 312
PpuMI RGGWCCY 1 cut(s) 295
PscI ACATGT 1 cut(s) 403
Psp5II RGGWCCY 1 cut(s) 295
Psp6I CCWGG 1 cut(s) 423
PspGI CCWGG 1 cut(s) 423
PspPI GGNCC 1 cut(s) 295
PspPPI RGGWCCY 1 cut(s) 295
PsuI RGATCY 1 cut(s) 197
RseI CAYNNNNRTG 1 cut(s) 470
SaqAI TTAA 5 cut(s) 63, 89, 143, 239, 420
SatI GCNGC 2 cut(s) 129, 361
Sau3AI GATC 3 cut(s) 148, 197, 348
Sau96I GGNCC 1 cut(s) 295
SchI GAGTC 1 cut(s) 313
ScrFI CCNGG 1 cut(s) 425
SetI ASST 5 cut(s) 160, 193, 297, 429, 493
SexAI ACCWGGT 1 cut(s) 423
SfaNI GCATC 1 cut(s) 495
SfcI CTRYAG 1 cut(s) 72
SinI GGWCC 1 cut(s) 295
SmiMI CAYNNNNRTG 1 cut(s) 470
Sse9I AATT 4 cut(s) 86, 184, 364, 417
SspI AATATT 1 cut(s) 124
SspMI CTAG 4 cut(s) 105, 171, 299, 540
StyD4I CCNGG 1 cut(s) 423
StyI CCWWGG 1 cut(s) 444
TaaI ACNGT 1 cut(s) 381
TasI AATT 4 cut(s) 86, 184, 364, 417
TfiI GAWTC 1 cut(s) 287
Tru1I TTAA 5 cut(s) 63, 89, 143, 239, 420
Tru9I TTAA 5 cut(s) 63, 89, 143, 239, 420
TscAI CASTG 1 cut(s) 466
TseI GCWGC 2 cut(s) 128, 360
TspDTI ATGAA 2 cut(s) 166, 469
TspRI CASTG 1 cut(s) 466
VpaK11BI GGWCC 1 cut(s) 295
XapI RAATTY 1 cut(s) 184
XceI RCATGY 1 cut(s) 407
XspI CTAG 4 cut(s) 105, 171, 299, 540
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.