Rmu_co8215414.1_g000001

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8215414.1
Physical Location & Seq
Reverse (-)
385 .. 705
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8215414.1_g000001.1.cds

Sequence Viewer

Length: 321 bp
atggcttggcagaatggttgtcgacagttgaaaatagaaatggattcgcttgttgcggtcaagttggttctctctcctattgatcatctacatcctctttatagtattgtggcaagttgtcaagagtttttgagtagggattggaatgtgtctcttacccatgtttacagagagtgtaattcagtggctgatttgttagcaagtattgggcatggctatgagccaggctgcagattctttagctcccctcctgctgatgtcgtgcctcttttggaagctgatctattgggcttgtctaagccaagattaattgtgatttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.78

Weight (kDa)

5.69

Isoelectric Point (pI)

32.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 22
AciI CCGC 1 cut(s) 56
AgsI TTSAA 1 cut(s) 31
AjnI CCWGG 1 cut(s) 223
AluBI AGCT 2 cut(s) 243, 278
AluI AGCT 2 cut(s) 243, 278
Alw26I GTCTC 1 cut(s) 156
AlwNI CAGNNNCTG 1 cut(s) 188
ApeKI GCWGC 1 cut(s) 228
AseI ATTAAT 1 cut(s) 308
BbvI GCAGC 1 cut(s) 215
BciT130I CCWGG 1 cut(s) 225
BclI TGATCA 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 229
BisI GCNGC 1 cut(s) 229
BlsI GCNGC 1 cut(s) 230
Bme1390I CCNGG 1 cut(s) 225
BmrFI CCNGG 1 cut(s) 225
BseBI CCWGG 1 cut(s) 225
BseGI GGATG 1 cut(s) 91
BseXI GCAGC 1 cut(s) 215
BsmAI GTCTC 1 cut(s) 156
Bsp143I GATC 2 cut(s) 82, 280
BspACI CCGC 1 cut(s) 56
BspMAI CTGCAG 1 cut(s) 233
BssMI GATC 2 cut(s) 82, 280
Bst2UI CCWGG 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 297
BstF5I GGATG 1 cut(s) 91
BstKTI GATC 2 cut(s) 85, 283
BstMAI GTCTC 1 cut(s) 156
BstMBI GATC 2 cut(s) 82, 280
BstNI CCWGG 1 cut(s) 225
BstSCI CCNGG 1 cut(s) 223
BstSFI CTRYAG 1 cut(s) 229
BstV1I GCAGC 1 cut(s) 215
BtsCI GGATG 1 cut(s) 91
BtsIMutI CAGTG 1 cut(s) 189
CaiI CAGNNNCTG 1 cut(s) 188
CviAII CATG 2 cut(s) 161, 212
CviJI RGCY 9 cut(s) 5, 188, 216, 223, 228, 243, 278, 291, 301
CviKI_1 RGCY 9 cut(s) 5, 188, 216, 223, 228, 243, 278, 291, 301
DdeI CTNAG 1 cut(s) 297
DpnI GATC 2 cut(s) 84, 282
DpnII GATC 2 cut(s) 82, 280
EcoRII CCWGG 1 cut(s) 223
FaeI CATG 2 cut(s) 164, 215
FaiI YATR 4 cut(s) 102, 162, 213, 219
FatI CATG 2 cut(s) 160, 211
FbaI TGATCA 1 cut(s) 82
FblI GTMKAC 1 cut(s) 22
Fnu4HI GCNGC 1 cut(s) 229
FokI GGATG 1 cut(s) 78
Fsp4HI GCNGC 1 cut(s) 229
GluI GCNGC 1 cut(s) 229
Hin1II CATG 2 cut(s) 164, 215
HincII GTYRAC 1 cut(s) 23
HindII GTYRAC 1 cut(s) 23
HinfI GANTC 2 cut(s) 44, 234
Hpy166II GTNNAC 2 cut(s) 23, 166
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 2 cut(s) 23, 166
HpyCH4III ACNGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 231
HpyF3I CTNAG 1 cut(s) 297
Hsp92II CATG 2 cut(s) 164, 215
Ksp22I TGATCA 1 cut(s) 82
Kzo9I GATC 2 cut(s) 82, 280
LmnI GCTCC 1 cut(s) 248
LpnPI CCDG 3 cut(s) 210, 237, 264
Lsp1109I GCAGC 1 cut(s) 215
MalI GATC 2 cut(s) 84, 282
MboI GATC 2 cut(s) 82, 280
MluCI AATT 2 cut(s) 178, 309
MnlI CCTC 3 cut(s) 105, 258, 276
MseI TTAA 1 cut(s) 308
MslI CAYNNNNRTG 1 cut(s) 216
MspR9I CCNGG 1 cut(s) 225
MvaI CCWGG 1 cut(s) 225
NdeII GATC 2 cut(s) 82, 280
NlaIII CATG 2 cut(s) 164, 215
PfeI GAWTC 2 cut(s) 44, 234
PkrI GCNGC 1 cut(s) 230
PshBI ATTAAT 1 cut(s) 308
Psp6I CCWGG 1 cut(s) 223
PspGI CCWGG 1 cut(s) 223
PstI CTGCAG 1 cut(s) 233
PstNI CAGNNNCTG 1 cut(s) 188
RseI CAYNNNNRTG 1 cut(s) 216
SalI GTCGAC 1 cut(s) 21
SaqAI TTAA 1 cut(s) 308
SatI GCNGC 1 cut(s) 229
Sau3AI GATC 2 cut(s) 82, 280
ScrFI CCNGG 1 cut(s) 225
SetI ASST 2 cut(s) 245, 280
SfcI CTRYAG 1 cut(s) 229
SmiMI CAYNNNNRTG 1 cut(s) 216
Sse9I AATT 2 cut(s) 178, 309
SsiI CCGC 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 223
TaaI ACNGT 1 cut(s) 27
TaqI TCGA 1 cut(s) 22
TasI AATT 2 cut(s) 178, 309
TfiI GAWTC 2 cut(s) 44, 234
Tru1I TTAA 1 cut(s) 308
Tru9I TTAA 1 cut(s) 308
TscAI CASTG 1 cut(s) 189
TseI GCWGC 1 cut(s) 228
TspRI CASTG 1 cut(s) 189
VspI ATTAAT 1 cut(s) 308
XmiI GTMKAC 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.