RchiOBHm_Chr6g0272021

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
32092057 .. 32092479
423 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24401

Sequence Viewer

Length: 264 bp
ATGGTAAAGAATGGAGTGGATGAAGTGCATCCTCTAAAGACCATCCTCAATTGTTGCTCATTCTTGCAGCAAAAGTTCCTGAGCTTTGATATTAGACACACCTATAGAGAAGTGAATGCAGTTGCAGATATCCTATCCAAGGATGGGTTGCAGGCTGAAGCTGGGGTGCATGTCATGTTGCATCCTCCTCCACAAGTCATTAACTCTCTTCTTGATGACTTGTGTGAATTTCCTAGAGTTAGGATTGTGAATTCCGAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.81

Weight (kDa)

5.69

Isoelectric Point (pI)

26.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 227, 250
AcuI CTGAAG 1 cut(s) 177
AfiI CCNNNNNNNGG 2 cut(s) 139, 144
AluBI AGCT 2 cut(s) 84, 161
AluI AGCT 2 cut(s) 84, 161
ApeKI GCWGC 1 cut(s) 67
ApoI RAATTY 2 cut(s) 227, 250
BbvI GCAGC 1 cut(s) 79
BccI CCATC 2 cut(s) 50, 137
BfaI CTAG 1 cut(s) 234
BfmI CTRYAG 1 cut(s) 103
BisI GCNGC 1 cut(s) 68
BlsI GCNGC 1 cut(s) 69
BmsI GCATC 2 cut(s) 37, 190
Bpu10I CCTNAGC 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 2 cut(s) 139, 144
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 5 cut(s) 25, 28, 42, 148, 181
BseLI CCNNNNNNNGG 2 cut(s) 139, 144
BseMII CTCAG 1 cut(s) 71
BseRI GAGGAG 1 cut(s) 177
BseXI GCAGC 1 cut(s) 79
BseYI CCCAGC 1 cut(s) 161
BslI CCNNNNNNNGG 2 cut(s) 139, 144
BsmI GAATGC 1 cut(s) 121
BspCNI CTCAG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 138
BssT1I CCWWGG 1 cut(s) 138
Bst6I CTCTTC 1 cut(s) 213
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 80
BstENI CCTNNNNNAGG 1 cut(s) 137
BstF5I GGATG 5 cut(s) 25, 28, 42, 148, 181
BstNSI RCATGY 1 cut(s) 173
BstSFI CTRYAG 1 cut(s) 103
BstV1I GCAGC 1 cut(s) 79
BtsCI GGATG 5 cut(s) 25, 28, 42, 148, 181
Cac8I GCNNGC 1 cut(s) 153
CviAII CATG 2 cut(s) 170, 175
CviJI RGCY 3 cut(s) 84, 155, 161
CviKI_1 RGCY 3 cut(s) 84, 155, 161
DdeI CTNAG 1 cut(s) 80
Eam1104I CTCTTC 1 cut(s) 213
EarI CTCTTC 1 cut(s) 213
Eco130I CCWWGG 1 cut(s) 138
Eco32I GATATC 1 cut(s) 130
Eco57I CTGAAG 1 cut(s) 177
EcoNI CCTNNNNNAGG 1 cut(s) 137
EcoRI GAATTC 1 cut(s) 250
EcoRV GATATC 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaeI CATG 2 cut(s) 173, 178
FaiI YATR 3 cut(s) 105, 171, 176
FatI CATG 2 cut(s) 169, 174
Fnu4HI GCNGC 1 cut(s) 68
FokI GGATG 5 cut(s) 15, 29, 32, 155, 168
Fsp4HI GCNGC 1 cut(s) 68
FspBI CTAG 1 cut(s) 234
GluI GCNGC 1 cut(s) 68
GsaI CCCAGC 1 cut(s) 165
Hin1II CATG 2 cut(s) 173, 178
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 2 cut(s) 79, 212
HpyCH4V TGCA 7 cut(s) 28, 67, 119, 125, 151, 169, 181
HpyF3I CTNAG 1 cut(s) 80
Hsp92II CATG 2 cut(s) 173, 178
LpnPI CCDG 3 cut(s) 92, 137, 147
Lsp1109I GCAGC 1 cut(s) 79
LweI GCATC 2 cut(s) 37, 190
MaeI CTAG 1 cut(s) 234
MboII GAAGA 1 cut(s) 200
MfeI CAATTG 1 cut(s) 49
MluCI AATT 3 cut(s) 49, 227, 250
MnlI CCTC 4 cut(s) 42, 56, 195, 198
MseI TTAA 1 cut(s) 201
MunI CAATTG 1 cut(s) 49
Mva1269I GAATGC 1 cut(s) 121
NlaIII CATG 2 cut(s) 173, 178
NspI RCATGY 1 cut(s) 173
PctI GAATGC 1 cut(s) 121
PkrI GCNGC 1 cut(s) 69
PspFI CCCAGC 1 cut(s) 161
SaqAI TTAA 1 cut(s) 201
SatI GCNGC 1 cut(s) 68
SetI ASST 3 cut(s) 86, 104, 163
SfaNI GCATC 2 cut(s) 37, 190
SfcI CTRYAG 1 cut(s) 103
Sse9I AATT 3 cut(s) 49, 227, 250
SspMI CTAG 1 cut(s) 234
StyI CCWWGG 1 cut(s) 138
TasI AATT 3 cut(s) 49, 227, 250
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TseI GCWGC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 36
XagI CCTNNNNNAGG 1 cut(s) 137
XapI RAATTY 2 cut(s) 227, 250
XceI RCATGY 1 cut(s) 173
XspI CTAG 1 cut(s) 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.