Rmu_sc0003826.1_g000010

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003826.1
Physical Location & Seq
Forward (+)
66148 .. 66769
622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003826.1_g000010.1.cds

Sequence Viewer

Length: 480 bp
atgaaaattgcaagccaaatcgcttccaatgctgctatggaatggtatcaattatcaagaactgccaatgttactagtgattattatttaaacatcttgccttggaaaaagcttctccctggaactgcaaagctgaatgttgatggtgctcgatgttgtgcaaatggtcgcattgctgctggtggagtcttaagatattataatggggattggatctgcggttttcaggccaaccttggtattggtcaagttttagatgttggaggcttggggcacatgctttctctgtttgattctgtgaaccttatgcatattttcagagaatgcaacggcactgcggatgctcttgcaaaatcgggccttgatcatgaccatggtgttgtcgtatttgactcccctcctccccatgttgcttctgcatttcttgatgatctcagtgaagtctccagatccaggtcttgtgttagacctgtaacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

159

Amino Acids

17.16

Weight (kDa)

6.49

Isoelectric Point (pI)

42.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 201
AciI CCGC 2 cut(s) 219, 338
AclWI GGATC 2 cut(s) 221, 444
AfiI CCNNNNNNNGG 1 cut(s) 453
AflII CTTAAG 1 cut(s) 190
AhlI ACTAGT 1 cut(s) 74
AjnI CCWGG 2 cut(s) 118, 452
AluBI AGCT 2 cut(s) 112, 133
AluI AGCT 2 cut(s) 112, 133
Alw21I GWGCWC 1 cut(s) 151
Alw26I GTCTC 1 cut(s) 448
AlwI GGATC 2 cut(s) 221, 444
AoxI GGCC 2 cut(s) 228, 358
ApeKI GCWGC 2 cut(s) 32, 176
AspS9I GGNCC 1 cut(s) 358
BaeGI GKGCMC 1 cut(s) 276
Bbv12I GWGCWC 1 cut(s) 151
BbvI GCAGC 2 cut(s) 19, 163
BccI CCATC 1 cut(s) 137
BceAI ACGGC 1 cut(s) 346
BciT130I CCWGG 2 cut(s) 120, 454
BclI TGATCA 1 cut(s) 364
BcoDI GTCTC 1 cut(s) 448
BcuI ACTAGT 1 cut(s) 74
BfaI CTAG 1 cut(s) 75
BfrI CTTAAG 1 cut(s) 190
BisI GCNGC 2 cut(s) 33, 177
BlsI GCNGC 2 cut(s) 34, 178
Bme1390I CCNGG 2 cut(s) 120, 454
BmgT120I GGNCC 1 cut(s) 358
BmrFI CCNGG 2 cut(s) 120, 454
BmsI GCATC 1 cut(s) 331
BpmI CTGGAG 1 cut(s) 430
BsaJI CCNNGG 4 cut(s) 101, 118, 235, 373
Bsc4I CCNNNNNNNGG 1 cut(s) 453
Bse3DI GCAATG 1 cut(s) 171
BseBI CCWGG 2 cut(s) 120, 454
BseDI CCNNGG 4 cut(s) 101, 118, 235, 373
BseGI GGATG 1 cut(s) 346
BseLI CCNNNNNNNGG 1 cut(s) 453
BseMI GCAATG 1 cut(s) 171
BseMII CTCAG 1 cut(s) 448
BseRI GAGGAG 1 cut(s) 390
BseSI GKGCMC 1 cut(s) 276
BseXI GCAGC 2 cut(s) 19, 163
BshFI GGCC 2 cut(s) 230, 360
BsiHKAI GWGCWC 1 cut(s) 151
BslI CCNNNNNNNGG 1 cut(s) 453
BsmAI GTCTC 1 cut(s) 448
BsmI GAATGC 1 cut(s) 329
BsnI GGCC 2 cut(s) 230, 360
Bsp1286I GDGCHC 2 cut(s) 151, 276
Bsp143I GATC 4 cut(s) 213, 364, 430, 449
Bsp19I CCATGG 1 cut(s) 373
BspACI CCGC 2 cut(s) 219, 338
BspANI GGCC 2 cut(s) 230, 360
BspCNI CTCAG 1 cut(s) 447
BspHI TCATGA 1 cut(s) 367
BspPI GGATC 2 cut(s) 221, 444
BspTI CTTAAG 1 cut(s) 190
BsrDI GCAATG 1 cut(s) 171
BssECI CCNNGG 4 cut(s) 101, 118, 235, 373
BssMI GATC 4 cut(s) 213, 364, 430, 449
BssT1I CCWWGG 3 cut(s) 101, 235, 373
Bst2UI CCWGG 2 cut(s) 120, 454
BstAFI CTTAAG 1 cut(s) 190
BstC8I GCNNGC 1 cut(s) 13
BstDEI CTNAG 2 cut(s) 434, 477
BstDSI CCRYGG 1 cut(s) 373
BstF5I GGATG 1 cut(s) 346
BstKTI GATC 4 cut(s) 216, 367, 433, 452
BstMAI GTCTC 1 cut(s) 448
BstMBI GATC 4 cut(s) 213, 364, 430, 449
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstNI CCWGG 2 cut(s) 120, 454
BstNSI RCATGY 1 cut(s) 280
BstSCI CCNGG 2 cut(s) 118, 452
BstSLI GKGCMC 1 cut(s) 276
BstV1I GCAGC 2 cut(s) 19, 163
BstX2I RGATCY 2 cut(s) 213, 449
BstYI RGATCY 2 cut(s) 213, 449
BsuRI GGCC 2 cut(s) 230, 360
BtgI CCRYGG 1 cut(s) 373
BtsCI GGATG 1 cut(s) 346
BtsI GCAGTG 1 cut(s) 333
BtsIMutI CAGTG 2 cut(s) 333, 442
Cac8I GCNNGC 1 cut(s) 13
CciI TCATGA 1 cut(s) 367
Cfr13I GGNCC 1 cut(s) 358
CviAII CATG 4 cut(s) 277, 368, 374, 407
CviJI RGCY 6 cut(s) 15, 112, 133, 230, 267, 360
CviKI_1 RGCY 6 cut(s) 15, 112, 133, 230, 267, 360
DdeI CTNAG 2 cut(s) 434, 477
DpnI GATC 4 cut(s) 215, 366, 432, 451
DpnII GATC 4 cut(s) 213, 364, 430, 449
DraI TTTAAA 1 cut(s) 90
Eco130I CCWWGG 3 cut(s) 101, 235, 373
EcoRII CCWGG 2 cut(s) 118, 452
EcoT14I CCWWGG 3 cut(s) 101, 235, 373
EcoT22I ATGCAT 1 cut(s) 312
ErhI CCWWGG 3 cut(s) 101, 235, 373
FaeI CATG 4 cut(s) 280, 371, 377, 410
FaiI YATR 8 cut(s) 38, 201, 278, 308, 312, 369, 375, 408
FatI CATG 4 cut(s) 276, 367, 373, 406
FbaI TGATCA 1 cut(s) 364
Fnu4HI GCNGC 2 cut(s) 33, 177
FokI GGATG 1 cut(s) 353
Fsp4HI GCNGC 2 cut(s) 33, 177
FspBI CTAG 1 cut(s) 75
GluI GCNGC 2 cut(s) 33, 177
GsuI CTGGAG 1 cut(s) 430
HaeIII GGCC 2 cut(s) 230, 360
Hin1II CATG 4 cut(s) 280, 371, 377, 410
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 3 cut(s) 186, 293, 392
Hpy166II GTNNAC 1 cut(s) 301
Hpy188I TCNGA 1 cut(s) 320
Hpy188III TCNNGA 4 cut(s) 57, 368, 425, 447
Hpy8I GTNNAC 1 cut(s) 301
HpyCH4V TGCA 7 cut(s) 11, 128, 161, 310, 327, 350, 419
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
HpyF3I CTNAG 2 cut(s) 434, 477
Hsp92II CATG 4 cut(s) 280, 371, 377, 410
Ksp22I TGATCA 1 cut(s) 364
Kzo9I GATC 4 cut(s) 213, 364, 430, 449
LpnPI CCDG 7 cut(s) 105, 132, 165, 212, 439, 460, 466
Lsp1109I GCAGC 2 cut(s) 19, 163
LweI GCATC 1 cut(s) 331
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 2 cut(s) 70, 472
MalI GATC 4 cut(s) 215, 366, 432, 451
MboI GATC 4 cut(s) 213, 364, 430, 449
MflI RGATCY 2 cut(s) 213, 449
MhlI GDGCHC 2 cut(s) 151, 276
MluCI AATT 2 cut(s) 6, 50
MlyI GAGTC 2 cut(s) 195, 386
MmeI TCCRAC 1 cut(s) 241
MnlI CCTC 3 cut(s) 257, 408, 411
Mph1103I ATGCAT 1 cut(s) 312
MseI TTAA 2 cut(s) 89, 191
MslI CAYNNNNRTG 1 cut(s) 372
MspCI CTTAAG 1 cut(s) 190
MspR9I CCNGG 2 cut(s) 120, 454
Mva1269I GAATGC 1 cut(s) 329
MvaI CCWGG 2 cut(s) 120, 454
MwoI GCNNNNNNNGC 1 cut(s) 29
NcoI CCATGG 1 cut(s) 373
NdeII GATC 4 cut(s) 213, 364, 430, 449
NlaIII CATG 4 cut(s) 280, 371, 377, 410
NsiI ATGCAT 1 cut(s) 312
NspI RCATGY 1 cut(s) 280
PagI TCATGA 1 cut(s) 367
PctI GAATGC 1 cut(s) 329
PfeI GAWTC 1 cut(s) 293
PkrI GCNGC 2 cut(s) 34, 178
PleI GAGTC 2 cut(s) 194, 386
PpsI GAGTC 2 cut(s) 194, 386
PsiI TTATAA 1 cut(s) 201
Psp6I CCWGG 2 cut(s) 118, 452
PspGI CCWGG 2 cut(s) 118, 452
PspPI GGNCC 1 cut(s) 358
PsuI RGATCY 2 cut(s) 213, 449
RseI CAYNNNNRTG 1 cut(s) 372
SaqAI TTAA 2 cut(s) 89, 191
SatI GCNGC 2 cut(s) 33, 177
Sau3AI GATC 4 cut(s) 213, 364, 430, 449
Sau96I GGNCC 1 cut(s) 358
SchI GAGTC 2 cut(s) 195, 386
ScrFI CCNGG 2 cut(s) 120, 454
SduI GDGCHC 2 cut(s) 151, 276
SetI ASST 6 cut(s) 114, 135, 237, 306, 458, 472
SfaNI GCATC 1 cut(s) 331
SmiMI CAYNNNNRTG 1 cut(s) 372
SmlI CTYRAG 1 cut(s) 190
SmoI CTYRAG 1 cut(s) 190
SpeI ACTAGT 1 cut(s) 74
Sse9I AATT 2 cut(s) 6, 50
SsiI CCGC 2 cut(s) 219, 338
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 2 cut(s) 118, 452
StyI CCWWGG 3 cut(s) 101, 235, 373
TaqI TCGA 1 cut(s) 151
TasI AATT 2 cut(s) 6, 50
TfiI GAWTC 1 cut(s) 293
Tru1I TTAA 2 cut(s) 89, 191
Tru9I TTAA 2 cut(s) 89, 191
TscAI CASTG 2 cut(s) 340, 442
TseI GCWGC 2 cut(s) 32, 176
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 340, 442
Vha464I CTTAAG 1 cut(s) 190
XceI RCATGY 1 cut(s) 280
XcmI CCANNNNNNNNNTGG 1 cut(s) 34
XspI CTAG 1 cut(s) 75
Zsp2I ATGCAT 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.