Rmu_sc0002132.1_g000045

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002132.1
Physical Location & Seq
Reverse (-)
183756 .. 184058
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002132.1_g000045.1.cds

Sequence Viewer

Length: 303 bp
atgatggttgaaagtgattctaaagttctagttaacatgatcaggcagggtgtgaatgatttacatccttctaaaactcttattgactgctgccagcttttgattagacagtttcctcattgtgaggttagctgccgcatttatcgtgagattaatcaggttgctgatgtgctttctaaatctggagtggatgttgggattgaagtgcatcttatggagcaacctcctccacaagctaattccttcttgttggatgactggtgtgaatatcctagatataggacagtagttcctagtgtgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.45

Weight (kDa)

5.19

Isoelectric Point (pI)

32.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000890)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 136
AgsI TTSAA 2 cut(s) 11, 203
AluBI AGCT 3 cut(s) 97, 132, 236
AluI AGCT 3 cut(s) 97, 132, 236
ApeKI GCWGC 2 cut(s) 90, 132
AseI ATTAAT 1 cut(s) 153
BbvI GCAGC 2 cut(s) 77, 119
BclI TGATCA 1 cut(s) 39
BfaI CTAG 3 cut(s) 29, 273, 294
BisI GCNGC 3 cut(s) 91, 133, 136
BlsI GCNGC 3 cut(s) 92, 134, 137
BmsI GCATC 1 cut(s) 217
BpmI CTGGAG 1 cut(s) 204
BsaBI GATNNNNATC 1 cut(s) 63
BsaXI ACNNNNNCTCC 2 cut(s) 177, 207
Bse1I ACTGG 1 cut(s) 263
Bse8I GATNNNNATC 1 cut(s) 63
BseGI GGATG 3 cut(s) 64, 196, 259
BseJI GATNNNNATC 1 cut(s) 63
BseNI ACTGG 1 cut(s) 263
BseRI GAGGAG 1 cut(s) 216
BseXI GCAGC 2 cut(s) 77, 119
Bsp143I GATC 1 cut(s) 39
BspACI CCGC 1 cut(s) 136
BsrI ACTGG 1 cut(s) 263
BssMI GATC 1 cut(s) 39
Bst4CI ACNGT 2 cut(s) 111, 286
BstC8I GCNNGC 1 cut(s) 95
BstF5I GGATG 3 cut(s) 64, 196, 259
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstV1I GCAGC 2 cut(s) 77, 119
BtsCI GGATG 3 cut(s) 64, 196, 259
Cac8I GCNNGC 1 cut(s) 95
CviAII CATG 1 cut(s) 37
CviJI RGCY 3 cut(s) 97, 132, 236
CviKI_1 RGCY 3 cut(s) 97, 132, 236
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
FaeI CATG 1 cut(s) 40
FaiI YATR 3 cut(s) 38, 215, 279
FalI AAGNNNNNCTT 2 cut(s) 195, 227
FatI CATG 1 cut(s) 36
FbaI TGATCA 1 cut(s) 39
Fnu4HI GCNGC 3 cut(s) 91, 133, 136
FokI GGATG 3 cut(s) 51, 203, 266
Fsp4HI GCNGC 3 cut(s) 91, 133, 136
FspBI CTAG 3 cut(s) 29, 273, 294
GluI GCNGC 3 cut(s) 91, 133, 136
GsuI CTGGAG 1 cut(s) 204
Hin1II CATG 1 cut(s) 40
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HinfI GANTC 1 cut(s) 17
HpaI GTTAAC 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 34
Hpy188III TCNNGA 2 cut(s) 146, 183
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 2 cut(s) 78, 253
HpyCH4III ACNGT 2 cut(s) 111, 286
HpyCH4V TGCA 1 cut(s) 208
Hsp92II CATG 1 cut(s) 40
Ksp22I TGATCA 1 cut(s) 39
KspAI GTTAAC 1 cut(s) 34
Kzo9I GATC 1 cut(s) 39
LmnI GCTCC 1 cut(s) 217
LpnPI CCDG 6 cut(s) 28, 32, 107, 143, 168, 244
Lsp1109I GCAGC 2 cut(s) 77, 119
LweI GCATC 1 cut(s) 217
MaeI CTAG 3 cut(s) 29, 273, 294
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MluCI AATT 1 cut(s) 238
MmeI TCCRAC 1 cut(s) 231
MnlI CCTC 4 cut(s) 118, 126, 234, 237
MseI TTAA 2 cut(s) 33, 153
NdeII GATC 1 cut(s) 39
NlaIII CATG 1 cut(s) 40
PfeI GAWTC 1 cut(s) 17
PkrI GCNGC 3 cut(s) 92, 134, 137
PshBI ATTAAT 1 cut(s) 153
SaqAI TTAA 2 cut(s) 33, 153
SatI GCNGC 3 cut(s) 91, 133, 136
Sau3AI GATC 1 cut(s) 39
SetI ASST 6 cut(s) 99, 129, 134, 162, 226, 238
SfaNI GCATC 1 cut(s) 217
Sse9I AATT 1 cut(s) 238
SsiI CCGC 1 cut(s) 136
SspMI CTAG 3 cut(s) 29, 273, 294
TaaI ACNGT 2 cut(s) 111, 286
TasI AATT 1 cut(s) 238
TauI GCSGC 1 cut(s) 138
TfiI GAWTC 1 cut(s) 17
Tru1I TTAA 2 cut(s) 33, 153
Tru9I TTAA 2 cut(s) 33, 153
TseI GCWGC 2 cut(s) 90, 132
VspI ATTAAT 1 cut(s) 153
XspI CTAG 3 cut(s) 29, 273, 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.