Prupe.1G206300_v2.0.a1

Domain of unknown function (DUF4220)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0000618
Physical Location & Seq
Forward (+)
20914984 .. 20915368
385 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G206300.1

Sequence Viewer

Length: 267 bp
ATGACGGTGGATTCCACGACCATTGAAAAACTGAATACACGACGGAGCGAGTCCGCATTGTTTGACGCATGTATTCTGGCCAAAGAGTTGGCCAAAATGGAGGAAAATAAATGGGAACTCATCAATAAAGTGTGGGTGGCCCAATTGCTGGGTAAAGGTGGAGAGCTTGTCACTTGTGTTTGGTTATTGATGGCTCATTTTGTTATCGGGGAGCAATTCCAAATAAACGAAGGCCGTGCAAGAGCAAAACTCATTGTGAAAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4220 DUF594

Protein Analysis

89

Amino Acids

10.0

Weight (kDa)

8.66

Isoelectric Point (pI)

44.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000618)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g04580 FvH4_3g37050 FvH4_3g37060 FvH4_4g30270 FvH4_6g34780 FvH4_6g34780
malus_domestica MD11G1092500.v1.1 MD17G1025500.v1.1
prunus_persica Prupe.1G206300_v2.0.a1 Prupe.3G040700_v2.0.a1 Prupe.3G040900_v2.0.a1 Prupe.3G041300_v2.0.a1 Prupe.3G041600_v2.0.a1 Prupe.3G061600_v2.0.a1 Prupe.4G109300_v2.0.a1 Prupe.6G069600_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.6G069800_v2.0.a1 Prupe.8G014800_v2.0.a1 Prupe.8G037600_v2.0.a1
pyrus_communis pycom09g10050 pycom17g16040
rosa_chinensis RchiOBHm_Chr2g0145601 RchiOBHm_Chr5g0066461 RchiOBHm_Chr5g0066471 RchiOBHm_Chr5g0066481
rosa_laevigata RLG00000019691 RLG00000020148 RLG00000020153 RLG00000035869 RLG00000035878 RLG00000035880
rosa_multiflora Rmu_co8287763.1_g000001 Rmu_co8480723.1_g000001 Rmu_co8493537.1_g000001 Rmu_sc0002170.1_g000044 Rmu_sc0002599.1_g000001 Rmu_sc0002718.1_g000013 Rmu_sc0003046.1_g000008 Rmu_sc0007761.1_g000002
rosa_roxburghii Rroxscaffold_152G00434590 Rroxscaffold_1G00014400 Rroxscaffold_1G00014410 Rroxscaffold_1G00014570 Rroxscaffold_2G00100650 Rroxscaffold_2G00106640
rosa_rugosa Rorug02G0392200 Rorug02G0392400 Rorug05G0378500 Rorug05G0378500 Rorug05G0378500
rosa_samantha Rh2AG446400 Rh2AG446500 Rh2BG457100 Rh2BG457200 Rh2BG457300 Rh2BG458200 Rh2CG432200 Rh2CG433100 Rh2CG433200 Rh2DG466800 Rh2DG466900 Rh2DG467000 Rh2DG467800 Rh3DG193900 Rh5AG437600 Rh5AG437700 Rh5AG437800 Rh5BG453700 Rh5DG468800 Rh7AG352500 Rh7CG369800 Rh7DG349000
rosa_wichuraiana Rw2G036410 Rw2G036460 Rw3G014910 Rw5G040940 Rw7G029760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 148
AciI CCGC 1 cut(s) 54
AcoI YGGCCR 2 cut(s) 78, 90
AfiI CCNNNNNNNGG 1 cut(s) 148
AgsI TTSAA 1 cut(s) 26
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
AoxI GGCC 4 cut(s) 78, 90, 138, 232
AspS9I GGNCC 1 cut(s) 139
BalI TGGCCA 2 cut(s) 80, 92
BccI CCATC 1 cut(s) 184
BceAI ACGGC 1 cut(s) 219
BcgI CGANNNNNNTGC 2 cut(s) 218, 252
BmgT120I GGNCC 1 cut(s) 139
BplI GAGNNNNNCTC 2 cut(s) 234, 266
BsaXI ACNNNNNCTCC 2 cut(s) 153, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 148
BseLI CCNNNNNNNGG 1 cut(s) 148
BseYI CCCAGC 1 cut(s) 148
BshFI GGCC 4 cut(s) 80, 92, 140, 234
BslI CCNNNNNNNGG 1 cut(s) 148
BsnI GGCC 4 cut(s) 80, 92, 140, 234
BspACI CCGC 1 cut(s) 54
BspANI GGCC 4 cut(s) 80, 92, 140, 234
Bst4CI ACNGT 1 cut(s) 7
BstNSI RCATGY 1 cut(s) 72
BstXI CCANNNNNNTGG 1 cut(s) 88
BsuRI GGCC 4 cut(s) 80, 92, 140, 234
Cfr13I GGNCC 1 cut(s) 139
CseI GACGC 1 cut(s) 74
CspCI CAANNNNNGTGG 2 cut(s) 4, 39
CviAII CATG 1 cut(s) 69
CviJI RGCY 6 cut(s) 80, 92, 140, 166, 194, 234
CviKI_1 RGCY 6 cut(s) 80, 92, 140, 166, 194, 234
EaeI YGGCCR 2 cut(s) 78, 90
FaeI CATG 1 cut(s) 72
FaiI YATR 1 cut(s) 70
FatI CATG 1 cut(s) 68
GsaI CCCAGC 1 cut(s) 152
HaeIII GGCC 4 cut(s) 80, 92, 140, 234
HgaI GACGC 1 cut(s) 74
Hin1II CATG 1 cut(s) 72
HinfI GANTC 2 cut(s) 11, 50
Hpy99I CGWCG 1 cut(s) 45
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 239
Hsp92II CATG 1 cut(s) 72
LmnI GCTCC 2 cut(s) 45, 211
LpnPI CCDG 2 cut(s) 62, 134
MaeIII GTNAC 1 cut(s) 169
MfeI CAATTG 1 cut(s) 143
MlsI TGGCCA 2 cut(s) 80, 92
MluCI AATT 2 cut(s) 143, 215
MluNI TGGCCA 2 cut(s) 80, 92
MlyI GAGTC 1 cut(s) 59
MnlI CCTC 1 cut(s) 94
Mox20I TGGCCA 2 cut(s) 80, 92
MscI TGGCCA 2 cut(s) 80, 92
Msp20I TGGCCA 2 cut(s) 80, 92
MunI CAATTG 1 cut(s) 143
NlaIII CATG 1 cut(s) 72
NmuCI GTSAC 1 cut(s) 169
NspI RCATGY 1 cut(s) 72
PfeI GAWTC 1 cut(s) 11
PflMI CCANNNNNTGG 1 cut(s) 148
PleI GAGTC 1 cut(s) 58
PpsI GAGTC 1 cut(s) 58
PspFI CCCAGC 1 cut(s) 148
PspPI GGNCC 1 cut(s) 139
Sau96I GGNCC 1 cut(s) 139
SchI GAGTC 1 cut(s) 59
SetI ASST 2 cut(s) 160, 168
Sse9I AATT 2 cut(s) 143, 215
SsiI CCGC 1 cut(s) 54
TaaI ACNGT 1 cut(s) 7
TasI AATT 2 cut(s) 143, 215
TfiI GAWTC 1 cut(s) 11
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
TspGWI ACGGA 1 cut(s) 58
Van91I CCANNNNNTGG 1 cut(s) 148
XceI RCATGY 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.